pycom12g13670

Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
16151929 .. 16152197
269 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g13670.2

Sequence Viewer

Length: 213 bp
ATGTCCCGACGAGGTGCCTCCGCCGTCGGTTTACGGATCGACGATCTGGATGAGGGGGAGTTGACGGACCAGATGATGGGTATAGTTAGGGTGTTGCGACTGAAGTTGTCGATTCAGGACTGTCTGATGAAGATGAAAATCGTCAAGAAATGCTTCGCCGGGAGCGAGATGGTGGAGGTCCTCATTAGGGATTTGGGAGAGAAGGGAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.76

Weight (kDa)

7.77

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024683)

Species Orthologous Gene IDs
pyrus_communis pycom12g13670
rosa_samantha Rh2DG672400 Rh5AG121800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 14
AccB7I CCANNNNNTGG 1 cut(s) 76
AciI CCGC 1 cut(s) 21
AclWI GGATC 1 cut(s) 44
AcuI CTGAAG 1 cut(s) 122
AfiI CCNNNNNNNGG 2 cut(s) 76, 187
AlwI GGATC 1 cut(s) 44
Asp700I GAANNNNTTC 1 cut(s) 152
AspS9I GGNCC 2 cut(s) 67, 178
AsuC2I CCSGG 1 cut(s) 160
AvaII GGWCC 2 cut(s) 67, 178
BanI GGYRCC 1 cut(s) 14
BccI CCATC 2 cut(s) 70, 163
BceAI ACGGC 1 cut(s) 8
BcnI CCSGG 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 160
Bme18I GGWCC 2 cut(s) 67, 178
BmgT120I GGNCC 2 cut(s) 67, 178
BmiI GGNNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 160
BpuMI CCSGG 1 cut(s) 160
BsaBI GATNNNNATC 1 cut(s) 137
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 187
Bse8I GATNNNNATC 1 cut(s) 137
BseGI GGATG 1 cut(s) 55
BseJI GATNNNNATC 1 cut(s) 137
BseLI CCNNNNNNNGG 2 cut(s) 76, 187
BshNI GGYRCC 1 cut(s) 14
BsiSI CCGG 1 cut(s) 159
BslI CCNNNNNNNGG 2 cut(s) 76, 187
Bsp143I GATC 2 cut(s) 36, 43
BspACI CCGC 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 16
BspPI GGATC 1 cut(s) 44
BspT107I GGYRCC 1 cut(s) 14
BssMI GATC 2 cut(s) 36, 43
Bst4CI ACNGT 1 cut(s) 122
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 2 cut(s) 39, 46
BstMBI GATC 2 cut(s) 36, 43
BstSCI CCNGG 1 cut(s) 158
BtsCI GGATG 1 cut(s) 55
Cfr13I GGNCC 2 cut(s) 67, 178
DpnI GATC 2 cut(s) 38, 45
DpnII GATC 2 cut(s) 36, 43
EciI GGCGGA 1 cut(s) 10
Eco47I GGWCC 2 cut(s) 67, 178
Eco57I CTGAAG 1 cut(s) 122
EcoO109I RGGNCCY 1 cut(s) 178
FaiI YATR 1 cut(s) 83
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FokI GGATG 1 cut(s) 62
HapII CCGG 1 cut(s) 159
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HinfI GANTC 1 cut(s) 112
HpaII CCGG 1 cut(s) 159
Hpy166II GTNNAC 2 cut(s) 32, 63
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 4 cut(s) 6, 47, 116, 145
Hpy8I GTNNAC 2 cut(s) 32, 63
Hpy99I CGWCG 3 cut(s) 12, 29, 44
HpyAV CCTTC 1 cut(s) 196
HpyCH4III ACNGT 1 cut(s) 122
Kzo9I GATC 2 cut(s) 36, 43
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 4 cut(s) 32, 83, 101, 172
MalI GATC 2 cut(s) 38, 45
MboI GATC 2 cut(s) 36, 43
MboII GAAGA 1 cut(s) 142
MnlI CCTC 6 cut(s) 5, 28, 46, 169, 191, 200
MroXI GAANNNNTTC 1 cut(s) 152
MspI CCGG 1 cut(s) 159
MspR9I CCNGG 1 cut(s) 160
NciI CCSGG 1 cut(s) 160
NdeII GATC 2 cut(s) 36, 43
NlaIV GGNNCC 1 cut(s) 16
PcsI WCGNNNNNNNCGW 1 cut(s) 162
PdmI GAANNNNTTC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 112
PflMI CCANNNNNTGG 1 cut(s) 76
PpuMI RGGWCCY 1 cut(s) 178
Psp5II RGGWCCY 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 16
PspPI GGNCC 2 cut(s) 67, 178
PspPPI RGGWCCY 1 cut(s) 178
Sau3AI GATC 2 cut(s) 36, 43
Sau96I GGNCC 2 cut(s) 67, 178
ScrFI CCNGG 1 cut(s) 160
SetI ASST 2 cut(s) 16, 180
SgeI CNNG 9 cut(s) 18, 23, 59, 82, 128, 157, 171, 172, 178
SinI GGWCC 2 cut(s) 67, 178
SsiI CCGC 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 158
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 2 cut(s) 39, 110
TfiI GAWTC 1 cut(s) 112
TspDTI ATGAA 2 cut(s) 143, 149
TspGWI ACGGA 2 cut(s) 49, 80
Van91I CCANNNNNTGG 1 cut(s) 76
VpaK11BI GGWCC 2 cut(s) 67, 178
XmnI GAANNNNTTC 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.