Rh2DG672400

Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
89460291 .. 89460569
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG672400.1

Sequence Viewer

Length: 279 bp
ATGATTGGGTCGAAATGCCTTGACGACGTGCCAGCTTCGCCTGTTTACGGGTTCGATGATCTCAAGGAGGAACTGACAGATCAGATGATAGGCATCGTGAAGGTGTTGAGGTTGAGATTGCCGATTCAGGACCGTCTGATGAAGATGAAGATTGTGAAGACTTCTCCAATCAGCCAAAAATGTTCAAAATGGTTGTTTTTGGCTTATCCAATCAGCCATAAATATATGCCTACCAAACATGGTATTGGAAAGGTGCAAAACTTCTCCAATCTTATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.51

Weight (kDa)

9.52

Isoelectric Point (pI)

47.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024683)

Species Orthologous Gene IDs
pyrus_communis pycom12g13670
rosa_samantha Rh2DG672400 Rh5AG121800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 1 cut(s) 186
AjiI CACGTC 1 cut(s) 28
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 130
AvaII GGWCC 1 cut(s) 130
BbsI GAAGAC 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 130
BmgBI CACGTC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 130
BmsI GCATC 1 cut(s) 102
BpiI GAAGAC 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 47
BsaBI GATNNNNATC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 47
Bse8I GATNNNNATC 1 cut(s) 92
BseJI GATNNNNATC 1 cut(s) 92
BseLI CCNNNNNNNGG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 47
Bsp143I GATC 2 cut(s) 58, 79
BssMI GATC 2 cut(s) 58, 79
Bst4CI ACNGT 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 33
BstKTI GATC 2 cut(s) 61, 82
BstMBI GATC 2 cut(s) 58, 79
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstV2I GAAGAC 1 cut(s) 164
BtrI CACGTC 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 130
CviAII CATG 1 cut(s) 239
CviJI RGCY 4 cut(s) 35, 174, 203, 216
CviKI_1 RGCY 4 cut(s) 35, 174, 203, 216
DpnI GATC 2 cut(s) 60, 81
DpnII GATC 2 cut(s) 58, 79
Eco47I GGWCC 1 cut(s) 130
FaeI CATG 1 cut(s) 242
FaiI YATR 4 cut(s) 219, 225, 227, 240
FatI CATG 1 cut(s) 238
Hin1II CATG 1 cut(s) 242
HinfI GANTC 1 cut(s) 124
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 2 cut(s) 84, 138
Hpy188III TCNNGA 2 cut(s) 97, 128
Hpy8I GTNNAC 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 29
HpyAV CCTTC 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 1 cut(s) 242
Kzo9I GATC 2 cut(s) 58, 79
LpnPI CCDG 3 cut(s) 45, 54, 113
LweI GCATC 1 cut(s) 102
MaeII ACGT 1 cut(s) 27
MalI GATC 2 cut(s) 60, 81
MboI GATC 2 cut(s) 58, 79
MboII GAAGA 3 cut(s) 154, 160, 169
MnlI CCTC 2 cut(s) 61, 102
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 2 cut(s) 58, 79
NlaIII CATG 1 cut(s) 242
PfeI GAWTC 1 cut(s) 124
PspPI GGNCC 1 cut(s) 130
Sau3AI GATC 2 cut(s) 58, 79
Sau96I GGNCC 1 cut(s) 130
SetI ASST 5 cut(s) 30, 37, 105, 113, 255
SfaNI GCATC 1 cut(s) 102
SgeI CNNG 9 cut(s) 32, 40, 44, 53, 61, 76, 109, 140, 251
SinI GGWCC 1 cut(s) 130
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
TaaI ACNGT 1 cut(s) 134
TaiI ACGT 1 cut(s) 30
TaqI TCGA 2 cut(s) 11, 54
TfiI GAWTC 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 155, 161
VpaK11BI GGWCC 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.