pycom13g28200

Component of the EKC KEOPS complex that is required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. The complex is probably involved in the transfer of the threonylcarbamoyl moiety of threonylcarbamoyl-AMP (TC-AMP) to the N6 group of A37. Likely plays a direct catalytic role in this reaction, but requires other protein(s) of the complex to fulfill this activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
24163196 .. 24163504
309 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g28200.1

Sequence Viewer

Length: 309 bp
ATGGCACAATGTGACAAGAAAGATGTCCTTATTGTTGGTGGTGTTGGTTGCAATGAACGGTTGCAAGAGGTGATGAGAACCATGTGCTCTGAACGGGGTGGAAGGTTGTTTGCAACCGATGATAGGTATTGTATTGATAATGGGGCCATGATTGCTTATACTGGTCTTCTTGCTTTTGCCAATGGCACATCAACACCGCTGGACAAGTCGACTTTTACCCAACGGTTTCGCACTGATGATGTTGAAGCAGTCTGGAGAATAAAAGAGGAATCAGAAAAAGTAAATGGATTGATGGATGAGAGTACCTGA

Protein Analysis

103

Amino Acids

11.38

Weight (kDa)

4.78

Isoelectric Point (pI)

14.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TsaD PF00814 2 - 53 4.2e-11 tRNA N6-adenosine threonylcarbamoyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024071)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g16550
pyrus_communis pycom13g28200
rosa_rugosa Rorug01G0083400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 209
AciI CCGC 1 cut(s) 197
AdeI CACNNNGTG 1 cut(s) 11
AfaI GTAC 1 cut(s) 304
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 1 cut(s) 245
Alw21I GWGCWC 1 cut(s) 89
AoxI GGCC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 144
AsuHPI GGTGA 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 89
BccI CCATC 1 cut(s) 286
BmgT120I GGNCC 1 cut(s) 144
BmiI GGNNCC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 274
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 166
Bse3DI GCAATG 1 cut(s) 58
BseGI GGATG 1 cut(s) 301
BseLI CCNNNNNNNGG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 166
BshFI GGCC 1 cut(s) 146
BsiHKAI GWGCWC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 123
BsnI GGCC 1 cut(s) 146
Bsp1286I GDGCHC 1 cut(s) 89
BspACI CCGC 1 cut(s) 197
BspANI GGCC 1 cut(s) 146
BspLI GGNNCC 1 cut(s) 145
BsrDI GCAATG 1 cut(s) 58
BsrI ACTGG 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 60, 225
BstF5I GGATG 1 cut(s) 301
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstV2I GAAGAC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 146
BtsCI GGATG 1 cut(s) 301
BtsIMutI CAGTG 1 cut(s) 231
Cfr13I GGNCC 1 cut(s) 144
Csp6I GTAC 1 cut(s) 303
CviAII CATG 2 cut(s) 82, 148
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
CviQI GTAC 1 cut(s) 303
DraIII CACNNNGTG 1 cut(s) 11
FaeI CATG 2 cut(s) 85, 151
FaiI YATR 3 cut(s) 83, 149, 159
FalI AAGNNNNNCTT 2 cut(s) 12, 44
FatI CATG 2 cut(s) 81, 147
FblI GTMKAC 1 cut(s) 209
GsuI CTGGAG 1 cut(s) 274
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 2 cut(s) 85, 151
HincII GTYRAC 1 cut(s) 210
HindII GTYRAC 1 cut(s) 210
HinfI GANTC 1 cut(s) 269
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 210
Hpy188I TCNGA 2 cut(s) 91, 274
Hpy188III TCNNGA 1 cut(s) 253
Hpy8I GTNNAC 1 cut(s) 210
HpyAV CCTTC 1 cut(s) 96
HpyCH4III ACNGT 2 cut(s) 60, 225
HpyCH4V TGCA 3 cut(s) 51, 64, 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Hsp92II CATG 2 cut(s) 85, 151
LpnPI CCDG 3 cut(s) 147, 185, 238
MaeIII GTNAC 1 cut(s) 11
MboII GAAGA 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 89
MnlI CCTC 2 cut(s) 61, 259
MspA1I CMGCKG 1 cut(s) 199
MwoI GCNNNNNNNGC 1 cut(s) 152
NlaIII CATG 2 cut(s) 85, 151
NlaIV GGNNCC 1 cut(s) 145
NmuCI GTSAC 1 cut(s) 11
PfeI GAWTC 1 cut(s) 269
PspN4I GGNNCC 1 cut(s) 145
PspPI GGNCC 1 cut(s) 144
RsaI GTAC 1 cut(s) 304
RsaNI GTAC 1 cut(s) 303
SalI GTCGAC 1 cut(s) 208
Sau96I GGNCC 1 cut(s) 144
SduI GDGCHC 1 cut(s) 89
SetI ASST 4 cut(s) 72, 107, 128, 308
SsiI CCGC 1 cut(s) 197
TaaI ACNGT 2 cut(s) 60, 225
TaqI TCGA 1 cut(s) 209
TfiI GAWTC 1 cut(s) 269
TscAI CASTG 1 cut(s) 238
TseFI GTSAC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 11
TspDTI ATGAA 1 cut(s) 69
TspRI CASTG 1 cut(s) 238
XmiI GTMKAC 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.