Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr16

Orthogroup ID

OG0020254

Physical Location & Seq

Genomic Coordinates Reverse (-)

14053173 .. 14053426

Gene Structure 254 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGTTATCTATTTTGGACATATATGTTTTTGAGCTTTTTGAAATAAATAAAATATGTGGAGTTTTTGGAGCGATAATTGGTATCTTTATTACATTAGCTAAAACTTATTTGTTCTTGTTCATTCTTATCACAACAAGATGGACTTTACCGAGGCTAAGAATGGACCAACTATTGAATCTTGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NADHdh

Protein Analysis

62

Amino Acids

7.1

Weight (kDa)

7.92

Isoelectric Point (pI)

31.02

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NADHdh	PF00146	21 - 61	3.5e-08	NADH dehydrogenase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020254)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG01100
pyrus_communis	pycom16g17800
rosa_chinensis	RchiOBHm_Chr3g0470801 RchiOBHm_CPg0502741
rosa_samantha	Rh3BG187600 Rh3CG177600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	41, 175
AluBI	AGCT	2 cut(s)	34, 98
AluI	AGCT	2 cut(s)	34, 98
AspS9I	GGNCC	1 cut(s)	163
AvaII	GGWCC	1 cut(s)	163
BccI	CCATC	1 cut(s)	132
Bme18I	GGWCC	1 cut(s)	163
BmgT120I	GGNCC	1 cut(s)	163
BsaJI	CCNNGG	1 cut(s)	149
BseDI	CCNNGG	1 cut(s)	149
BssECI	CCNNGG	1 cut(s)	149
BstDEI	CTNAG	1 cut(s)	155
Cfr13I	GGNCC	1 cut(s)	163
CviJI	RGCY	3 cut(s)	34, 98, 154
CviKI_1	RGCY	3 cut(s)	34, 98, 154
DdeI	CTNAG	1 cut(s)	155
Eco47I	GGWCC	1 cut(s)	163
FaiI	YATR	4 cut(s)	20, 22, 24, 55
FalI	AAGNNNNNCTT	2 cut(s)	127, 159
FspEI	CC	9 cut(s)	42, 51, 63, 124, 136, 146, 162, 165, 179
HinfI	GANTC	1 cut(s)	175
HpyF3I	CTNAG	1 cut(s)	155
LmnI	GCTCC	1 cut(s)	68
MluCI	AATT	1 cut(s)	75
MnlI	CCTC	1 cut(s)	144
PfeI	GAWTC	1 cut(s)	175
PspPI	GGNCC	1 cut(s)	163
Sau96I	GGNCC	1 cut(s)	163
SetI	ASST	2 cut(s)	36, 100
SgeI	CNNG	3 cut(s)	127, 147, 162
SinI	GGWCC	1 cut(s)	163
Sse9I	AATT	1 cut(s)	75
TasI	AATT	1 cut(s)	75
TfiI	GAWTC	1 cut(s)	175
TspDTI	ATGAA	1 cut(s)	109
VpaK11BI	GGWCC	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.