Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020254

Physical Location & Seq

Genomic Coordinates Forward (+)

138480 .. 147986

Gene Structure 9507 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ15735

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGGTCTTTGGAGCGACAATTGGTATCTTTATTACATTAACTAAAACTTATTTGTTCTTGTTCATTCCTATCACAACAAGATGGACTTTGCCGAGGCTAAGAATGGACCAACTATTAAATCTTGGATGGAAATTTCTTTTACCGATCTCTCTCGGTAATCTATTATTAACAACTTCTTCCCAACTCTTTTCGCTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NADHdh

Protein Analysis

65

Amino Acids

7.46

Weight (kDa)

11.0

Isoelectric Point (pI)

27.54

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NADHdh	PF00146	8 - 57	9.3e-14	NADH dehydrogenase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020254)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG01100
pyrus_communis	pycom16g17800
rosa_chinensis	RchiOBHm_Chr3g0470801 RchiOBHm_CPg0502741
rosa_samantha	Rh3BG187600 Rh3CG177600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	131
ApoI	RAATTY	1 cut(s)	131
AspS9I	GGNCC	1 cut(s)	106
AvaII	GGWCC	1 cut(s)	106
BccI	CCATC	2 cut(s)	75, 120
Bme18I	GGWCC	1 cut(s)	106
BmgT120I	GGNCC	1 cut(s)	106
BsaJI	CCNNGG	1 cut(s)	92
BseDI	CCNNGG	1 cut(s)	92
BseGI	GGATG	1 cut(s)	131
Bsp143I	GATC	1 cut(s)	144
BssECI	CCNNGG	1 cut(s)	92
BssMI	GATC	1 cut(s)	144
BstDEI	CTNAG	1 cut(s)	98
BstF5I	GGATG	1 cut(s)	131
BstKTI	GATC	1 cut(s)	147
BstMBI	GATC	1 cut(s)	144
BtsCI	GGATG	1 cut(s)	131
Cfr13I	GGNCC	1 cut(s)	106
CviJI	RGCY	1 cut(s)	97
CviKI_1	RGCY	1 cut(s)	97
DdeI	CTNAG	1 cut(s)	98
DpnI	GATC	1 cut(s)	146
DpnII	GATC	1 cut(s)	144
Eco47I	GGWCC	1 cut(s)	106
FaiI	YATR	1 cut(s)	196
FalI	AAGNNNNNCTT	2 cut(s)	70, 102
FokI	GGATG	1 cut(s)	138
HpyF3I	CTNAG	1 cut(s)	98
Kzo9I	GATC	1 cut(s)	144
LmnI	GCTCC	1 cut(s)	11
MalI	GATC	1 cut(s)	146
MboI	GATC	1 cut(s)	144
MboII	GAAGA	1 cut(s)	168
MfeI	CAATTG	1 cut(s)	18
MluCI	AATT	2 cut(s)	18, 131
MnlI	CCTC	1 cut(s)	87
MseI	TTAA	3 cut(s)	38, 116, 167
MunI	CAATTG	1 cut(s)	18
NdeII	GATC	1 cut(s)	144
NmeAIII	GCCGAG	1 cut(s)	117
PspPI	GGNCC	1 cut(s)	106
SaqAI	TTAA	3 cut(s)	38, 116, 167
Sau3AI	GATC	1 cut(s)	144
Sau96I	GGNCC	1 cut(s)	106
SgeI	CNNG	5 cut(s)	70, 90, 105, 134, 164
SinI	GGWCC	1 cut(s)	106
Sse9I	AATT	2 cut(s)	18, 131
TasI	AATT	2 cut(s)	18, 131
Tru1I	TTAA	3 cut(s)	38, 116, 167
Tru9I	TTAA	3 cut(s)	38, 116, 167
TspDTI	ATGAA	1 cut(s)	52
VpaK11BI	GGWCC	1 cut(s)	106
XapI	RAATTY	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.