pycom17g04810

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
3290733 .. 3291257
525 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGGTCGTCATTGGTTTCTGAGATTTCTCGTTGTTTCTTGCCTTCTCGCTCTCTGTTTCTCTCACGGATTCGGGAGAAAGCTGGTGGAGACTGCTGAGCATGGTGAAGATTCTTCGGTTCTAGTCTCAAAGGAAAATCATGGAAAATCGAGGAAGATGATCACATTGATGGATTATGCAGATCCAGAACCGAATGTGAACCCGAGAACAGGGTATATCTTGACCCCTCCTCCTCAGCTCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.15

Weight (kDa)

7.86

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015887)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G15265 AT5G15265
fragaria_vesca FvH4_6g48260
malus_domestica MD00G1125200.v1.1 MD09G1052600.v1.1
prunus_persica Prupe.3G266100_v2.0.a1 Prupe.3G266100_v2.0.a1
pyrus_communis pycom17g04810
rosa_chinensis RchiOBHm_Chr2g0167761
rosa_multiflora Rmu_co8387187.1_g000001 Rmu_sc0042171.1_g000002
rosa_roxburghii Rroxscaffold_2G00083280
rosa_rugosa Rorug02G0531900
rosa_samantha Rh2BG611500
rosa_wichuraiana Rw2G049880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 209
AluBI AGCT 2 cut(s) 82, 238
AluI AGCT 2 cut(s) 82, 238
Alw26I GTCTC 2 cut(s) 83, 130
AlwI GGATC 1 cut(s) 176
Ama87I CYCGRG 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 116
AvaI CYCGRG 1 cut(s) 202
BbvCI CCTCAGC 1 cut(s) 234
BccI CCATC 1 cut(s) 163
BclI TGATCA 1 cut(s) 159
BcoDI GTCTC 2 cut(s) 83, 130
BfaI CTAG 1 cut(s) 122
BlpI GCTNAGC 1 cut(s) 96
BmeT110I CYCGRG 1 cut(s) 202
Bpu10I CCTNAGC 1 cut(s) 234
Bpu1102I GCTNAGC 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 214, 244
Bsc4I CCNNNNNNNGG 1 cut(s) 209
BseLI CCNNNNNNNGG 1 cut(s) 209
BseMII CTCAG 2 cut(s) 11, 87
BseRI GAGGAG 2 cut(s) 219, 222
BsiHKCI CYCGRG 1 cut(s) 202
BslI CCNNNNNNNGG 1 cut(s) 209
BsmAI GTCTC 2 cut(s) 83, 130
BsoBI CYCGRG 1 cut(s) 202
Bsp143I GATC 2 cut(s) 159, 181
Bsp1720I GCTNAGC 1 cut(s) 96
BspCNI CTCAG 2 cut(s) 12, 88
BspPI GGATC 1 cut(s) 176
BssMI GATC 2 cut(s) 159, 181
BstDEI CTNAG 3 cut(s) 20, 96, 234
BstKTI GATC 2 cut(s) 162, 184
BstMAI GTCTC 2 cut(s) 83, 130
BstMBI GATC 2 cut(s) 159, 181
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
CviAII CATG 2 cut(s) 101, 140
CviJI RGCY 2 cut(s) 82, 238
CviKI_1 RGCY 2 cut(s) 82, 238
DdeI CTNAG 3 cut(s) 20, 96, 234
DpnI GATC 2 cut(s) 161, 183
DpnII GATC 2 cut(s) 159, 181
Eco88I CYCGRG 1 cut(s) 202
FaeI CATG 2 cut(s) 104, 143
FaiI YATR 4 cut(s) 102, 141, 177, 216
FatI CATG 2 cut(s) 100, 139
FbaI TGATCA 1 cut(s) 159
FspBI CTAG 1 cut(s) 122
Hin1II CATG 2 cut(s) 104, 143
HinfI GANTC 2 cut(s) 69, 110
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 3 cut(s) 73, 185, 220
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 53
HpyCH4V TGCA 1 cut(s) 179
HpyF3I CTNAG 3 cut(s) 20, 96, 234
Hsp92II CATG 2 cut(s) 104, 143
Ksp22I TGATCA 1 cut(s) 159
Kzo9I GATC 2 cut(s) 159, 181
LpnPI CCDG 3 cut(s) 68, 195, 198
MaeI CTAG 1 cut(s) 122
MalI GATC 2 cut(s) 161, 183
MboI GATC 2 cut(s) 159, 181
MboII GAAGA 3 cut(s) 105, 119, 166
MflI RGATCY 1 cut(s) 181
MnlI CCTC 4 cut(s) 144, 237, 240, 243
MslI CAYNNNNRTG 1 cut(s) 167
NdeII GATC 2 cut(s) 159, 181
NlaIII CATG 2 cut(s) 104, 143
PfeI GAWTC 2 cut(s) 69, 110
PsuI RGATCY 1 cut(s) 181
RseI CAYNNNNRTG 1 cut(s) 167
Sau3AI GATC 2 cut(s) 159, 181
SetI ASST 2 cut(s) 84, 240
SmiMI CAYNNNNRTG 1 cut(s) 167
SspMI CTAG 1 cut(s) 122
TaqI TCGA 1 cut(s) 149
TfiI GAWTC 2 cut(s) 69, 110
TspGWI ACGGA 1 cut(s) 81
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.