pycom17g20820

Lys-63-specific deubiquitinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
19259664 .. 19264462
4799 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g20820.1

Sequence Viewer

Length: 261 bp
ATGTCTTTGGCGTCTGTGAAAATGTCGGAGGACGTGTGGCTGACGTGCCTCACTCACGCATTGTCCACCGAGACGGAGGAGATCATGGGCCTCCTGCTTGGTGACATTGAGAACTCTGTAAATGGCAGCGTGACAGCACTAATTTGGGGAGCATCACCTCAGACACGATCTGATCGGAGGAAGGATCGTGTGGAGACTAATCCTGAGCAGTTGGCTGCTGCATCAGCCCAGAATGACACTGTCAACTGGAAGAACAACTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.42

Weight (kDa)

4.61

Isoelectric Point (pI)

58.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
JAB PF01398 3 - 69 5.1e-06 JAB1/Mov34/MPN/PAD-1 ubiquitin protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021289)

Species Orthologous Gene IDs
pyrus_communis pycom17g20820
rosa_chinensis RchiOBHm_Chr2g0136631
rosa_multiflora Rmu_sc0006440.1_g000006
rosa_samantha Rh2BG389600 Rh2CG369300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 192
AcyI GRCGYC 1 cut(s) 11
AflIII ACRYGT 1 cut(s) 33
AjiI CACGTC 2 cut(s) 34, 45
Alw26I GTCTC 2 cut(s) 65, 188
AlwI GGATC 1 cut(s) 192
AoxI GGCC 1 cut(s) 88
ApeKI GCWGC 3 cut(s) 126, 215, 218
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 2 cut(s) 113, 147
BbvI GCAGC 3 cut(s) 138, 202, 205
BcoDI GTCTC 2 cut(s) 65, 188
BfaI CTAG 1 cut(s) 259
BisI GCNGC 3 cut(s) 127, 216, 219
BlsI GCNGC 3 cut(s) 128, 217, 220
BmgBI CACGTC 2 cut(s) 34, 45
BmgT120I GGNCC 1 cut(s) 88
BmsI GCATC 2 cut(s) 161, 230
Bpu10I CCTNAGC 1 cut(s) 204
BsaHI GRCGYC 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
Bse1I ACTGG 1 cut(s) 251
BseMII CTCAG 2 cut(s) 173, 195
BseNI ACTGG 1 cut(s) 251
BseRI GAGGAG 1 cut(s) 92
BseXI GCAGC 3 cut(s) 138, 202, 205
BshFI GGCC 1 cut(s) 90
BsmAI GTCTC 2 cut(s) 65, 188
BsmBI CGTCTC 1 cut(s) 65
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 4 cut(s) 81, 167, 172, 184
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 172, 196
BspPI GGATC 1 cut(s) 192
BsrI ACTGG 1 cut(s) 251
BssMI GATC 4 cut(s) 81, 167, 172, 184
BssNI GRCGYC 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 241
BstACI GRCGYC 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 159, 204
BstKTI GATC 4 cut(s) 84, 170, 175, 187
BstMAI GTCTC 2 cut(s) 65, 188
BstMBI GATC 4 cut(s) 81, 167, 172, 184
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstV1I GCAGC 3 cut(s) 138, 202, 205
BsuRI GGCC 1 cut(s) 90
BtrI CACGTC 2 cut(s) 34, 45
BtsIMutI CAGTG 1 cut(s) 237
Cfr13I GGNCC 1 cut(s) 88
CviAII CATG 1 cut(s) 85
CviJI RGCY 4 cut(s) 40, 90, 215, 227
CviKI_1 RGCY 4 cut(s) 40, 90, 215, 227
DdeI CTNAG 2 cut(s) 159, 204
DpnI GATC 4 cut(s) 83, 169, 174, 186
DpnII GATC 4 cut(s) 81, 167, 172, 184
Esp3I CGTCTC 1 cut(s) 65
FaeI CATG 1 cut(s) 88
FaiI YATR 1 cut(s) 86
FatI CATG 1 cut(s) 84
Fnu4HI GCNGC 3 cut(s) 127, 216, 219
Fsp4HI GCNGC 3 cut(s) 127, 216, 219
FspBI CTAG 1 cut(s) 259
GluI GCNGC 3 cut(s) 127, 216, 219
HaeIII GGCC 1 cut(s) 90
Hin1I GRCGYC 1 cut(s) 11
Hin1II CATG 1 cut(s) 88
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HphI GGTGA 2 cut(s) 113, 147
Hpy166II GTNNAC 2 cut(s) 66, 244
Hpy188I TCNGA 4 cut(s) 28, 162, 172, 177
Hpy188III TCNNGA 1 cut(s) 203
Hpy8I GTNNAC 2 cut(s) 66, 244
HpyAV CCTTC 1 cut(s) 175
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 2 cut(s) 33, 44
HpyCH4V TGCA 1 cut(s) 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 159, 204
HpySE526I ACGT 2 cut(s) 33, 44
Hsp92I GRCGYC 1 cut(s) 11
Hsp92II CATG 1 cut(s) 88
Kzo9I GATC 4 cut(s) 81, 167, 172, 184
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 4 cut(s) 107, 216, 232, 242
Lsp1109I GCAGC 3 cut(s) 138, 202, 205
LweI GCATC 2 cut(s) 161, 230
MaeI CTAG 1 cut(s) 259
MaeII ACGT 2 cut(s) 33, 44
MaeIII GTNAC 2 cut(s) 101, 130
MalI GATC 4 cut(s) 83, 169, 174, 186
MboI GATC 4 cut(s) 81, 167, 172, 184
MluCI AATT 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 6
MnlI CCTC 6 cut(s) 22, 59, 70, 101, 168, 171
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 4 cut(s) 81, 167, 172, 184
NlaIII CATG 1 cut(s) 88
NmuCI GTSAC 2 cut(s) 101, 130
PflFI GACNNNGTC 1 cut(s) 239
PkrI GCNGC 3 cut(s) 128, 217, 220
PspPI GGNCC 1 cut(s) 88
PsyI GACNNNGTC 1 cut(s) 239
SatI GCNGC 3 cut(s) 127, 216, 219
Sau3AI GATC 4 cut(s) 81, 167, 172, 184
Sau96I GGNCC 1 cut(s) 88
SetI ASST 3 cut(s) 36, 47, 160
SfaNI GCATC 2 cut(s) 161, 230
Sse9I AATT 1 cut(s) 141
SspMI CTAG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 2 cut(s) 36, 47
TasI AATT 1 cut(s) 141
TscAI CASTG 1 cut(s) 244
TseFI GTSAC 2 cut(s) 101, 130
TseI GCWGC 3 cut(s) 126, 215, 218
Tsp45I GTSAC 2 cut(s) 101, 130
TspGWI ACGGA 1 cut(s) 89
TspRI CASTG 1 cut(s) 244
Tth111I GACNNNGTC 1 cut(s) 239
XspI CTAG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.