RCHIOBHM_CPG0502501

One of the components of the core complex of photosystem II (PSII). PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
OG0022044
Physical Location & Seq
Reverse (-)
104835 .. 105814
980 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGTTTGTTATGCTTAATATTTTAAGTTTGATCTGTATCTACCTTAATTCTGCTCTTTATTCCAGTAGTTTTTTCGTCGCCAAATTGCCCGAAGCCTACGCTTTTTTGAATCCAATTGTAGATGTTATGCCAGTAATACCCCTGTTCTTTTTTCTCTTAGCCTTTGTTTGGCAAGCTGCTGTAAGTTTTCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsbK

Protein Analysis

64

Amino Acids

7.31

Weight (kDa)

5.82

Isoelectric Point (pI)

39.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbK PF02533 24 - 64 5e-24 Photosystem II 4 kDa reaction centre component
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022044)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00070
malus_domestica MD03G1146700.v1.1
rosa_chinensis RchiOBHm_CPg0502501
rosa_rugosa RorugMtG0001400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 168
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
ApeKI GCWGC 1 cut(s) 176
BbvI GCAGC 1 cut(s) 163
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
BsaBI GATNNNNATC 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 168
Bse1I ACTGG 2 cut(s) 63, 131
Bse8I GATNNNNATC 1 cut(s) 35
BseJI GATNNNNATC 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 168
BseNI ACTGG 2 cut(s) 63, 131
BseXI GCAGC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 168
Bsp143I GATC 1 cut(s) 30
BsrI ACTGG 2 cut(s) 63, 131
BssMI GATC 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 157
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstV1I GCAGC 1 cut(s) 163
Cac8I GCNNGC 1 cut(s) 174
CviJI RGCY 3 cut(s) 95, 161, 176
CviKI_1 RGCY 3 cut(s) 95, 161, 176
DdeI CTNAG 1 cut(s) 157
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
FaiI YATR 2 cut(s) 11, 128
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
HinfI GANTC 1 cut(s) 109
Hpy99I CGWCG 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 3 cut(s) 76, 144, 155
Lsp1109I GCAGC 1 cut(s) 163
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MfeI CAATTG 1 cut(s) 114
MluCI AATT 3 cut(s) 46, 83, 114
MseI TTAA 3 cut(s) 15, 23, 45
MunI CAATTG 1 cut(s) 114
NdeII GATC 1 cut(s) 30
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 1 cut(s) 178
SaqAI TTAA 3 cut(s) 15, 23, 45
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 30
SetI ASST 2 cut(s) 45, 178
SgeI CNNG 5 cut(s) 75, 101, 143, 154, 185
Sse9I AATT 3 cut(s) 46, 83, 114
SspI AATATT 1 cut(s) 19
TaqI TCGA 1 cut(s) 190
TasI AATT 3 cut(s) 46, 83, 114
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 3 cut(s) 15, 23, 45
Tru9I TTAA 3 cut(s) 15, 23, 45
TseI GCWGC 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.