Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020376

Physical Location & Seq

Genomic Coordinates Forward (+)

25458628 .. 25458807

Gene Structure 180 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGGATGCAATGAAGGTGATAGCAATGCTTTTGGCGATCTGGGGCTTTCTTTCCTACATATATCAACATTACCTAGATGACTTAAAATCCAAGGAAAACAGAATGGCAATCAAATTTCTAGGATTGCCTGAGAGAATTCAGAAATTAATTTCCAAGATGATATTTGAAATTAACTTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PUNUT

Protein Analysis

59

Amino Acids

7.01

Weight (kDa)

9.1

Isoelectric Point (pI)

26.86

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PUNUT	PF16913	1 - 28	1.2e-06	Purine nucleobase transmembrane transport

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020376)

Species	Orthologous Gene IDs
malus_domestica	MD02G1225500.v1.1
rosa_chinensis	RchiOBHm_Chr7g0208091
rosa_rugosa	Rorug05G0007800
rosa_samantha	Rh5BG098300 Rh5CG110500 Rh5DG097600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	113, 135
AgsI	TTSAA	1 cut(s)	167
ApoI	RAATTY	2 cut(s)	113, 135
AseI	ATTAAT	1 cut(s)	146
AsuHPI	GGTGA	1 cut(s)	28
BfaI	CTAG	2 cut(s)	74, 119
BsaJI	CCNNGG	1 cut(s)	90
Bse3DI	GCAATG	2 cut(s)	15, 30
BseDI	CCNNGG	1 cut(s)	90
BseGI	GGATG	1 cut(s)	10
BseMI	GCAATG	2 cut(s)	15, 30
BseMII	CTCAG	1 cut(s)	120
Bsp143I	GATC	1 cut(s)	36
BspCNI	CTCAG	1 cut(s)	121
BsrDI	GCAATG	2 cut(s)	15, 30
BssECI	CCNNGG	1 cut(s)	90
BssMI	GATC	1 cut(s)	36
BssT1I	CCWWGG	1 cut(s)	90
BstDEI	CTNAG	1 cut(s)	129
BstF5I	GGATG	1 cut(s)	10
BstKTI	GATC	1 cut(s)	39
BstMBI	GATC	1 cut(s)	36
BtsCI	GGATG	1 cut(s)	10
CviJI	RGCY	1 cut(s)	45
CviKI_1	RGCY	1 cut(s)	45
DdeI	CTNAG	1 cut(s)	129
DpnI	GATC	1 cut(s)	38
DpnII	GATC	1 cut(s)	36
Eco130I	CCWWGG	1 cut(s)	90
EcoRI	GAATTC	1 cut(s)	135
EcoT14I	CCWWGG	1 cut(s)	90
ErhI	CCWWGG	1 cut(s)	90
FaiI	YATR	3 cut(s)	59, 61, 178
FokI	GGATG	1 cut(s)	17
FspBI	CTAG	2 cut(s)	74, 119
HphI	GGTGA	1 cut(s)	28
Hpy188I	TCNGA	1 cut(s)	141
HpyAV	CCTTC	1 cut(s)	7
HpyCH4V	TGCA	1 cut(s)	8
HpyF3I	CTNAG	1 cut(s)	129
Kzo9I	GATC	1 cut(s)	36
LpnPI	CCDG	2 cut(s)	25, 141
MaeI	CTAG	2 cut(s)	74, 119
MalI	GATC	1 cut(s)	38
MboI	GATC	1 cut(s)	36
MluCI	AATT	5 cut(s)	113, 135, 143, 147, 168
MseI	TTAA	3 cut(s)	83, 146, 171
NdeII	GATC	1 cut(s)	36
PshBI	ATTAAT	1 cut(s)	146
SaqAI	TTAA	3 cut(s)	83, 146, 171
Sau3AI	GATC	1 cut(s)	36
SetI	ASST	2 cut(s)	18, 75
SgeI	CNNG	6 cut(s)	52, 86, 103, 131, 140, 166
Sse9I	AATT	5 cut(s)	113, 135, 143, 147, 168
SspMI	CTAG	2 cut(s)	74, 119
StyI	CCWWGG	1 cut(s)	90
TasI	AATT	5 cut(s)	113, 135, 143, 147, 168
Tru1I	TTAA	3 cut(s)	83, 146, 171
Tru9I	TTAA	3 cut(s)	83, 146, 171
TspDTI	ATGAA	1 cut(s)	26
VspI	ATTAAT	1 cut(s)	146
XapI	RAATTY	2 cut(s)	113, 135
XspI	CTAG	2 cut(s)	74, 119

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.