RchiOBHm_Chr6g0291721

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0022796
Physical Location & Seq
Reverse (-)
54764080 .. 54764337
258 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGCGGATAACTGGGCTACCAGAGGTGGATATATTGCAGAAGATAGATTGGACCCAAGCACCCTTTACTGCATCTTACAGGAACTTCAGTGCCAATTCCAATTCCCAGGGAGCATGGTACTGGAACAAGTTGGACTACTCGGGTAAAGGCCAGATGCAATGGGTGCAAAAGAACTATATGATCTACAACTACTGCACAGACGCAAAGCGATTCCCCTTAGGGTTTGATCCTGAATGTTATTTGACTAATCTGTCCTAG

Protein Analysis

85

Amino Acids

9.99

Weight (kDa)

7.72

Isoelectric Point (pI)

36.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
XET_C PF06955 35 - 79 7.8e-20 Xyloglucan endo-transglycosylase (XET) C-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022796)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0291721
rosa_multiflora Rmu_sc0002226.1_g000024
rosa_rugosa Rorug06G0221300
rosa_samantha Rh4BG109000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 250
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 221
AcuI CTGAAG 1 cut(s) 70
AfaI GTAC 1 cut(s) 119
AjnI CCWGG 1 cut(s) 105
AlwI GGATC 1 cut(s) 221
Ama87I CYCGRG 1 cut(s) 139
AoxI GGCC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 51
AvaI CYCGRG 1 cut(s) 139
AvaII GGWCC 1 cut(s) 51
AxyI CCTNAGG 1 cut(s) 217
BciT130I CCWGG 1 cut(s) 107
BfaI CTAG 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 107
Bme18I GGWCC 1 cut(s) 51
BmeT110I CYCGRG 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 51
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 21
BmsI GCATC 2 cut(s) 80, 144
BmuI ACTGGG 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 105, 106
Bse1I ACTGG 2 cut(s) 16, 125
Bse21I CCTNAGG 1 cut(s) 217
Bse3DI GCAATG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 2 cut(s) 105, 106
BseMI GCAATG 1 cut(s) 164
BseNI ACTGG 2 cut(s) 16, 125
BsgI GTGCAG 1 cut(s) 178
BshFI GGCC 1 cut(s) 150
BsiHKCI CYCGRG 1 cut(s) 139
BsnI GGCC 1 cut(s) 150
BsoBI CYCGRG 1 cut(s) 139
Bsp143I GATC 2 cut(s) 180, 226
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 150
BspLI GGNNCC 1 cut(s) 53
BspPI GGATC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 164
BsrI ACTGG 2 cut(s) 16, 125
BssECI CCNNGG 2 cut(s) 105, 106
BssMI GATC 2 cut(s) 180, 226
Bst2UI CCWGG 1 cut(s) 107
BstAPI GCANNNNNTGC 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 217
BstKTI GATC 2 cut(s) 183, 229
BstMBI GATC 2 cut(s) 180, 226
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 105
Bsu36I CCTNAGG 1 cut(s) 217
BsuRI GGCC 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 51
CseI GACGC 1 cut(s) 209
Csp6I GTAC 1 cut(s) 118
CviAII CATG 1 cut(s) 114
CviJI RGCY 2 cut(s) 16, 150
CviKI_1 RGCY 2 cut(s) 16, 150
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 217
DpnI GATC 2 cut(s) 182, 228
DpnII GATC 2 cut(s) 180, 226
DrdI GACNNNNNNGTC 1 cut(s) 250
DseDI GACNNNNNNGTC 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 70
Eco81I CCTNAGG 1 cut(s) 217
Eco88I CYCGRG 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 105
FaeI CATG 1 cut(s) 117
FaiI YATR 4 cut(s) 32, 115, 177, 179
FatI CATG 1 cut(s) 113
FspBI CTAG 1 cut(s) 256
HaeIII GGCC 1 cut(s) 150
HgaI GACGC 1 cut(s) 209
Hin1II CATG 1 cut(s) 117
HinfI GANTC 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 230
HpyCH4V TGCA 5 cut(s) 37, 71, 157, 166, 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 217
Hsp92II CATG 1 cut(s) 117
Kzo9I GATC 2 cut(s) 180, 226
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 7 cut(s) 33, 64, 92, 106, 119, 164, 243
LweI GCATC 2 cut(s) 80, 144
MaeI CTAG 1 cut(s) 256
MalI GATC 2 cut(s) 182, 228
MboI GATC 2 cut(s) 180, 226
MboII GAAGA 1 cut(s) 52
MluCI AATT 2 cut(s) 94, 100
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 163
NdeII GATC 2 cut(s) 180, 226
NlaIII CATG 1 cut(s) 117
NlaIV GGNNCC 1 cut(s) 53
PasI CCCWGGG 1 cut(s) 106
PfeI GAWTC 1 cut(s) 210
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspN4I GGNNCC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 51
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
Sau3AI GATC 2 cut(s) 180, 226
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 107
SetI ASST 1 cut(s) 27
SfaNI GCATC 2 cut(s) 80, 144
SinI GGWCC 1 cut(s) 51
Sse9I AATT 2 cut(s) 94, 100
SsiI CCGC 1 cut(s) 4
SspMI CTAG 1 cut(s) 256
StyD4I CCNGG 1 cut(s) 105
TasI AATT 2 cut(s) 94, 100
TfiI GAWTC 1 cut(s) 210
TscAI CASTG 1 cut(s) 94
TspRI CASTG 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 51
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.