Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002226.1

Orthogroup ID

OG0022796

Physical Location & Seq

Genomic Coordinates Reverse (-)

104655 .. 106864

Gene Structure 2210 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002226.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 597 bp

atgcctagtggtccaccgaaagttataattactgatcaagatctagcaattgcaaaagccattgctcaagttcttccacttacactccaccgtttttgtctttggcatatcatgtttaaatttcgagataagcttggtcctgtgattgctcaaagttattatggactcttcaaagccagtgtatataactccaagactacagaagaatttgaagctagttggaagaatgatgtgcaacaaagtagtcaagaaaatcatgcgtggttgaacacaatgtatgaactacgaagtaaatgggtccctgcattttgcaatcacatctttcatgcagtctctggaatgcggataactgggctaccagaggtggatatattgcagaagatagattggacccaagcaccctttaccgcatcttacaggaacttcagtgccaattccaattcccagggagcatggtactggaacaagttggactattcgggtaaaggccagatgcaatgggtgcaaaagaactatatgatctacaactactgcacagacgcaaagcgattccccttagggtttgatcctgaatgttatttgactaatctgtcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAR1 MULE SWIM

Protein Analysis

198

Amino Acids

22.96

Weight (kDa)

8.59

Isoelectric Point (pI)

49.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022796)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0291721
rosa_multiflora	Rmu_sc0002226.1_g000024
rosa_rugosa	Rorug06G0221300
rosa_samantha	Rh4BG109000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	26
AasI	GACNNNNNNGTC	1 cut(s)	589
AciI	CCGC	2 cut(s)	343, 408
AclWI	GGATC	1 cut(s)	560
AcsI	RAATTY	2 cut(s)	119, 206
AcuI	CTGAAG	1 cut(s)	409
AfaI	GTAC	1 cut(s)	458
AgsI	TTSAA	3 cut(s)	172, 212, 268
AjnI	CCWGG	1 cut(s)	444
AluBI	AGCT	2 cut(s)	133, 215
AluI	AGCT	2 cut(s)	133, 215
Alw26I	GTCTC	1 cut(s)	337
AlwI	GGATC	1 cut(s)	560
AlwNI	CAGNNNCTG	1 cut(s)	335
AoxI	GGCC	1 cut(s)	487
ApoI	RAATTY	2 cut(s)	119, 206
AspS9I	GGNCC	4 cut(s)	11, 137, 298, 390
AvaII	GGWCC	4 cut(s)	11, 137, 298, 390
AxyI	CCTNAGG	1 cut(s)	556
BciT130I	CCWGG	1 cut(s)	446
BclI	TGATCA	1 cut(s)	34
BcoDI	GTCTC	1 cut(s)	337
BfaI	CTAG	4 cut(s)	6, 44, 216, 595
BfmI	CTRYAG	1 cut(s)	198
BglII	AGATCT	1 cut(s)	40
Bme1390I	CCNGG	1 cut(s)	446
Bme18I	GGWCC	4 cut(s)	11, 137, 298, 390
BmgT120I	GGNCC	4 cut(s)	11, 137, 298, 390
BmiI	GGNNCC	3 cut(s)	299, 300, 392
BmrFI	CCNGG	1 cut(s)	446
BmrI	ACTGGG	1 cut(s)	360
BmsI	GCATC	2 cut(s)	419, 483
BmuI	ACTGGG	1 cut(s)	360
BpuEI	CTTGAG	1 cut(s)	51
BsaBI	GATNNNNATC	1 cut(s)	39
BsaJI	CCNNGG	2 cut(s)	444, 445
BsaXI	ACNNNNNCTCC	2 cut(s)	69, 99
Bse1I	ACTGG	3 cut(s)	177, 355, 464
Bse21I	CCTNAGG	1 cut(s)	556
Bse3DI	GCAATG	2 cut(s)	60, 503
Bse8I	GATNNNNATC	1 cut(s)	39
BseBI	CCWGG	1 cut(s)	446
BseDI	CCNNGG	2 cut(s)	444, 445
BseJI	GATNNNNATC	1 cut(s)	39
BseMI	GCAATG	2 cut(s)	60, 503
BseNI	ACTGG	3 cut(s)	177, 355, 464
BsgI	GTGCAG	1 cut(s)	517
BshFI	GGCC	1 cut(s)	489
BslFI	GGGAC	1 cut(s)	284
BsmAI	GTCTC	1 cut(s)	337
BsmFI	GGGAC	1 cut(s)	284
BsmI	GAATGC	1 cut(s)	345
BsnI	GGCC	1 cut(s)	489
Bsp143I	GATC	4 cut(s)	34, 40, 519, 565
BspACI	CCGC	2 cut(s)	343, 408
BspANI	GGCC	1 cut(s)	489
BspLI	GGNNCC	3 cut(s)	299, 300, 392
BspPI	GGATC	1 cut(s)	560
BsrDI	GCAATG	2 cut(s)	60, 503
BsrI	ACTGG	3 cut(s)	177, 355, 464
BssECI	CCNNGG	2 cut(s)	444, 445
BssMI	GATC	4 cut(s)	34, 40, 519, 565
Bst2UI	CCWGG	1 cut(s)	446
Bst4CI	ACNGT	1 cut(s)	92
Bst6I	CTCTTC	1 cut(s)	173
BstAPI	GCANNNNNTGC	1 cut(s)	502
BstDEI	CTNAG	1 cut(s)	556
BstKTI	GATC	4 cut(s)	37, 43, 522, 568
BstMAI	GTCTC	1 cut(s)	337
BstMBI	GATC	4 cut(s)	34, 40, 519, 565
BstMWI	GCNNNNNNNGC	1 cut(s)	502
BstNI	CCWGG	1 cut(s)	446
BstSCI	CCNGG	1 cut(s)	444
BstSFI	CTRYAG	1 cut(s)	198
BstX2I	RGATCY	1 cut(s)	40
BstYI	RGATCY	1 cut(s)	40
Bsu36I	CCTNAGG	1 cut(s)	556
BsuRI	GGCC	1 cut(s)	489
BtsIMutI	CAGTG	2 cut(s)	184, 433
CaiI	CAGNNNCTG	1 cut(s)	335
Cfr13I	GGNCC	4 cut(s)	11, 137, 298, 390
CseI	GACGC	1 cut(s)	548
Csp6I	GTAC	1 cut(s)	457
CspCI	CAANNNNNGTGG	2 cut(s)	77, 112
CviAII	CATG	4 cut(s)	112, 257, 326, 453
CviJI	RGCY	6 cut(s)	59, 133, 176, 215, 355, 489
CviKI_1	RGCY	6 cut(s)	59, 133, 176, 215, 355, 489
CviQI	GTAC	1 cut(s)	457
DdeI	CTNAG	1 cut(s)	556
DpnI	GATC	4 cut(s)	36, 42, 521, 567
DpnII	GATC	4 cut(s)	34, 40, 519, 565
DraI	TTTAAA	1 cut(s)	118
DrdI	GACNNNNNNGTC	1 cut(s)	589
DseDI	GACNNNNNNGTC	1 cut(s)	589
Eam1104I	CTCTTC	1 cut(s)	173
EarI	CTCTTC	1 cut(s)	173
Eco47I	GGWCC	4 cut(s)	11, 137, 298, 390
Eco57I	CTGAAG	1 cut(s)	409
Eco81I	CCTNAGG	1 cut(s)	556
EcoO109I	RGGNCCY	1 cut(s)	298
EcoRII	CCWGG	1 cut(s)	444
FaeI	CATG	4 cut(s)	115, 260, 329, 456
FaqI	GGGAC	1 cut(s)	284
FatI	CATG	4 cut(s)	111, 256, 325, 452
FbaI	TGATCA	1 cut(s)	34
FspBI	CTAG	4 cut(s)	6, 44, 216, 595
HaeIII	GGCC	1 cut(s)	489
HgaI	GACGC	1 cut(s)	548
Hin1II	CATG	4 cut(s)	115, 260, 329, 456
HindIII	AAGCTT	1 cut(s)	131
HinfI	GANTC	2 cut(s)	165, 549
Hpy166II	GTNNAC	1 cut(s)	14
Hpy188III	TCNNGA	5 cut(s)	38, 125, 248, 336, 569
Hpy8I	GTNNAC	1 cut(s)	14
HpyCH4III	ACNGT	1 cut(s)	92
HpyCH4V	TGCA	9 cut(s)	53, 235, 305, 312, 329, 376, 496, 505, 534
HpyF10VI	GCNNNNNNNGC	1 cut(s)	502
HpyF3I	CTNAG	1 cut(s)	556
Hsp92II	CATG	4 cut(s)	115, 260, 329, 456
KflI	GGGWCCC	1 cut(s)	298
Ksp22I	TGATCA	1 cut(s)	34
Kzo9I	GATC	4 cut(s)	34, 40, 519, 565
LmnI	GCTCC	1 cut(s)	449
LweI	GCATC	2 cut(s)	419, 483
MaeI	CTAG	4 cut(s)	6, 44, 216, 595
MalI	GATC	4 cut(s)	36, 42, 521, 567
MboI	GATC	4 cut(s)	34, 40, 519, 565
MboII	GAAGA	5 cut(s)	65, 160, 215, 235, 391
MfeI	CAATTG	1 cut(s)	48
MflI	RGATCY	1 cut(s)	40
MluCI	AATT	6 cut(s)	27, 48, 119, 206, 433, 439
MlyI	GAGTC	1 cut(s)	159
MmeI	TCCRAC	2 cut(s)	200, 450
MnlI	CCTC	1 cut(s)	355
MseI	TTAA	1 cut(s)	117
MspR9I	CCNGG	1 cut(s)	446
MunI	CAATTG	1 cut(s)	48
Mva1269I	GAATGC	1 cut(s)	345
MvaI	CCWGG	1 cut(s)	446
MwoI	GCNNNNNNNGC	1 cut(s)	502
NdeII	GATC	4 cut(s)	34, 40, 519, 565
NlaIII	CATG	4 cut(s)	115, 260, 329, 456
NlaIV	GGNNCC	3 cut(s)	299, 300, 392
PasI	CCCWGGG	1 cut(s)	445
PctI	GAATGC	1 cut(s)	345
PfeI	GAWTC	1 cut(s)	549
PleI	GAGTC	1 cut(s)	159
PpsI	GAGTC	1 cut(s)	159
PpuMI	RGGWCCY	1 cut(s)	298
PsiI	TTATAA	1 cut(s)	26
Psp5II	RGGWCCY	1 cut(s)	298
Psp6I	CCWGG	1 cut(s)	444
PspGI	CCWGG	1 cut(s)	444
PspN4I	GGNNCC	3 cut(s)	299, 300, 392
PspPI	GGNCC	4 cut(s)	11, 137, 298, 390
PspPPI	RGGWCCY	1 cut(s)	298
PstNI	CAGNNNCTG	1 cut(s)	335
PsuI	RGATCY	1 cut(s)	40
RsaI	GTAC	1 cut(s)	458
RsaNI	GTAC	1 cut(s)	457
SaqAI	TTAA	1 cut(s)	117
Sau3AI	GATC	4 cut(s)	34, 40, 519, 565
Sau96I	GGNCC	4 cut(s)	11, 137, 298, 390
SchI	GAGTC	1 cut(s)	159
ScrFI	CCNGG	1 cut(s)	446
SetI	ASST	3 cut(s)	135, 217, 366
SfaNI	GCATC	2 cut(s)	419, 483
SfcI	CTRYAG	1 cut(s)	198
SinI	GGWCC	4 cut(s)	11, 137, 298, 390
SmlI	CTYRAG	1 cut(s)	66
SmoI	CTYRAG	1 cut(s)	66
Sse9I	AATT	6 cut(s)	27, 48, 119, 206, 433, 439
SsiI	CCGC	2 cut(s)	343, 408
SspMI	CTAG	4 cut(s)	6, 44, 216, 595
StyD4I	CCNGG	1 cut(s)	444
TaaI	ACNGT	1 cut(s)	92
TaqI	TCGA	1 cut(s)	124
TasI	AATT	6 cut(s)	27, 48, 119, 206, 433, 439
TfiI	GAWTC	1 cut(s)	549
Tru1I	TTAA	1 cut(s)	117
Tru9I	TTAA	1 cut(s)	117
TscAI	CASTG	2 cut(s)	184, 433
TspDTI	ATGAA	2 cut(s)	294, 314
TspRI	CASTG	2 cut(s)	184, 433
VpaK11BI	GGWCC	4 cut(s)	11, 137, 298, 390
XapI	RAATTY	2 cut(s)	119, 206
XspI	CTAG	4 cut(s)	6, 44, 216, 595

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.