RchiOBHm_Chr5g0005591

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
3594784 .. 3595182
399 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGGGAGCTGATCATTTCATATGGCAGAGCTTTGATTATCCTGGTGATACAATGCTGCCTAACATGGTGCTGGGATACAATAGAAAATCTGGAAAGAGCAGTGTCTTGACAGCCTGGAAAAATGAGAATGATCCATCCACTGGGATATTCTCGGCTGCAGGTGGATTGGTAAAGGAGATGCCAGGACAAGTAATCAAATGGATGAATCGATCAACTCCCAACTGGAAAAGTGGGCCATGGGATCAAAGTTCATCGGCATACATGATATGGATAACCAATATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

94

Amino Acids

10.53

Weight (kDa)

8.03

Isoelectric Point (pI)

41.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 4 - 40 4.6e-11 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022176)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g03435
rosa_chinensis RchiOBHm_Chr5g0005591
rosa_samantha Rh5CG051400
rosa_wichuraiana Rw5G004360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 149
Acc36I ACCTGC 1 cut(s) 149
AccB7I CCANNNNNTGG 1 cut(s) 140
AclWI GGATC 2 cut(s) 125, 249
AfiI CCNNNNNNNGG 1 cut(s) 140
AjnI CCWGG 3 cut(s) 40, 113, 181
AluBI AGCT 2 cut(s) 8, 30
AluI AGCT 2 cut(s) 8, 30
AlwI GGATC 2 cut(s) 125, 249
AoxI GGCC 1 cut(s) 233
ApeKI GCWGC 2 cut(s) 55, 155
AspS9I GGNCC 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 56
BbvI GCAGC 2 cut(s) 42, 142
BccI CCATC 1 cut(s) 142
BciT130I CCWGG 3 cut(s) 42, 115, 183
BciVI GTATCC 1 cut(s) 68
BclI TGATCA 1 cut(s) 10
BfmI CTRYAG 1 cut(s) 156
BfuAI ACCTGC 1 cut(s) 149
BfuI GTATCC 1 cut(s) 68
BisI GCNGC 2 cut(s) 56, 156
BlsI GCNGC 2 cut(s) 57, 157
Bme1390I CCNGG 3 cut(s) 42, 115, 183
BmgT120I GGNCC 1 cut(s) 233
BmrFI CCNGG 3 cut(s) 42, 115, 183
BmrI ACTGGG 1 cut(s) 150
BmsI GCATC 1 cut(s) 168
BmuI ACTGGG 1 cut(s) 150
Bsa29I ATCGAT 1 cut(s) 208
BsaJI CCNNGG 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse1I ACTGG 2 cut(s) 145, 227
BseBI CCWGG 3 cut(s) 42, 115, 183
BseCI ATCGAT 1 cut(s) 208
BseDI CCNNGG 1 cut(s) 236
BseGI GGATG 2 cut(s) 134, 207
BseLI CCNNNNNNNGG 1 cut(s) 140
BseNI ACTGG 2 cut(s) 145, 227
BseXI GCAGC 2 cut(s) 42, 142
BseYI CCCAGC 1 cut(s) 70
BshFI GGCC 1 cut(s) 235
BshVI ATCGAT 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 140
BsnI GGCC 1 cut(s) 235
Bsp143I GATC 4 cut(s) 10, 130, 209, 241
Bsp19I CCATGG 1 cut(s) 236
BspANI GGCC 1 cut(s) 235
BspDI ATCGAT 1 cut(s) 208
BspMAI CTGCAG 1 cut(s) 160
BspMI ACCTGC 1 cut(s) 149
BspPI GGATC 2 cut(s) 125, 249
BsrI ACTGG 2 cut(s) 145, 227
BssECI CCNNGG 1 cut(s) 236
BssMI GATC 4 cut(s) 10, 130, 209, 241
BssT1I CCWWGG 1 cut(s) 236
Bst2UI CCWGG 3 cut(s) 42, 115, 183
BstDSI CCRYGG 1 cut(s) 236
BstF5I GGATG 2 cut(s) 134, 207
BstKTI GATC 4 cut(s) 13, 133, 212, 244
BstMBI GATC 4 cut(s) 10, 130, 209, 241
BstNI CCWGG 3 cut(s) 42, 115, 183
BstSCI CCNGG 3 cut(s) 40, 113, 181
BstSFI CTRYAG 1 cut(s) 156
BstV1I GCAGC 2 cut(s) 42, 142
Bsu15I ATCGAT 1 cut(s) 208
BsuI GTATCC 1 cut(s) 68
BsuRI GGCC 1 cut(s) 235
BsuTUI ATCGAT 1 cut(s) 208
BtgI CCRYGG 1 cut(s) 236
BtsCI GGATG 2 cut(s) 134, 207
BtsI GCAGTG 1 cut(s) 106
BtsIMutI CAGTG 2 cut(s) 106, 138
BveI ACCTGC 1 cut(s) 149
Cfr13I GGNCC 1 cut(s) 233
ClaI ATCGAT 1 cut(s) 208
CviAII CATG 3 cut(s) 64, 237, 262
CviJI RGCY 5 cut(s) 8, 30, 113, 155, 235
CviKI_1 RGCY 5 cut(s) 8, 30, 113, 155, 235
DpnI GATC 4 cut(s) 12, 132, 211, 243
DpnII GATC 4 cut(s) 10, 130, 209, 241
Eco130I CCWWGG 1 cut(s) 236
EcoRII CCWGG 3 cut(s) 40, 113, 181
EcoT14I CCWWGG 1 cut(s) 236
ErhI CCWWGG 1 cut(s) 236
FaeI CATG 3 cut(s) 67, 240, 265
FaiI YATR 7 cut(s) 20, 22, 65, 238, 259, 263, 268
FatI CATG 3 cut(s) 63, 236, 261
FauNDI CATATG 1 cut(s) 20
FbaI TGATCA 1 cut(s) 10
Fnu4HI GCNGC 2 cut(s) 56, 156
FokI GGATG 2 cut(s) 121, 214
Fsp4HI GCNGC 2 cut(s) 56, 156
GluI GCNGC 2 cut(s) 56, 156
GsaI CCCAGC 1 cut(s) 74
HaeIII GGCC 1 cut(s) 235
Hin1II CATG 3 cut(s) 67, 240, 265
HinfI GANTC 1 cut(s) 205
HphI GGTGA 1 cut(s) 56
Hpy188III TCNNGA 2 cut(s) 90, 106
HpyCH4V TGCA 1 cut(s) 158
Hsp92II CATG 3 cut(s) 67, 240, 265
Ksp22I TGATCA 1 cut(s) 10
Kzo9I GATC 4 cut(s) 10, 130, 209, 241
LmnI GCTCC 1 cut(s) 5
Lsp1109I GCAGC 2 cut(s) 42, 142
LweI GCATC 1 cut(s) 168
MalI GATC 4 cut(s) 12, 132, 211, 243
MboI GATC 4 cut(s) 10, 130, 209, 241
MspR9I CCNGG 3 cut(s) 42, 115, 183
MvaI CCWGG 3 cut(s) 42, 115, 183
NcoI CCATGG 1 cut(s) 236
NdeI CATATG 1 cut(s) 20
NdeII GATC 4 cut(s) 10, 130, 209, 241
NlaIII CATG 3 cut(s) 67, 240, 265
NmeAIII GCCGAG 1 cut(s) 131
PaqCI CACCTGC 1 cut(s) 149
PfeI GAWTC 1 cut(s) 205
PflMI CCANNNNNTGG 1 cut(s) 140
PkrI GCNGC 2 cut(s) 57, 157
Psp6I CCWGG 3 cut(s) 40, 113, 181
PspFI CCCAGC 1 cut(s) 70
PspGI CCWGG 3 cut(s) 40, 113, 181
PspPI GGNCC 1 cut(s) 233
PstI CTGCAG 1 cut(s) 160
SatI GCNGC 2 cut(s) 56, 156
Sau3AI GATC 4 cut(s) 10, 130, 209, 241
Sau96I GGNCC 1 cut(s) 233
ScrFI CCNGG 3 cut(s) 42, 115, 183
SetI ASST 3 cut(s) 10, 32, 163
SfaNI GCATC 1 cut(s) 168
SfcI CTRYAG 1 cut(s) 156
StyD4I CCNGG 3 cut(s) 40, 113, 181
StyI CCWWGG 1 cut(s) 236
TaqI TCGA 1 cut(s) 208
TfiI GAWTC 1 cut(s) 205
TscAI CASTG 2 cut(s) 106, 145
TseI GCWGC 2 cut(s) 55, 155
TspDTI ATGAA 3 cut(s) 7, 218, 240
TspRI CASTG 2 cut(s) 106, 145
Van91I CCANNNNNTGG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.