RchiOBHm_Chr5g0024071

Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
18273179 .. 18274288
1110 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 438 bp
ATGACAATTATATGTGAAGCACTATATGTTAAGCATTTTTTTACTTGCCCTTACTTATCAGTATGTTTTTCACTTTTGAAATATTGGAATCTTTGCGAGAACTTGGCAATGTTCTATGTGGAGTACAACGTATCCTATGTGTACCATGCCATGTATGCCTACTTCAACAGGGATAATGTCGCACTCAGGGGTCTTGCCAAATTTTTCAAGGAACCAAGTGAGGAGGAGGGGGAGCATGCTGAGAAATTGATGGAATACCAGAATAAGCGTGGTGGAAGGGTGAAATTGAAATCAATACTGATGCCTCTCTCAGAGTTCGATCATGCTGAGAAGGGAGATGCTCTATATGCAATGGAGATTGCATTGTCTCTGAAGAAACTGACAAATGAAAAGCTACTCCACTTGCACCATGTAAGGGATCTATTATTTACTGCTTAG

Protein Analysis

145

Amino Acids

17.06

Weight (kDa)

6.65

Isoelectric Point (pI)

31.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ferritin PF00210 41 - 138 1.4e-16 Ferritin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022758)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0024071
rosa_laevigata RLG00000025316
rosa_samantha Rh5CG184200 Rh5DG170800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 426
AcsI RAATTY 1 cut(s) 200
AcuI CTGAAG 1 cut(s) 392
AfaI GTAC 2 cut(s) 125, 143
AfiI CCNNNNNNNGG 1 cut(s) 415
AgsI TTSAA 4 cut(s) 79, 166, 208, 289
AluBI AGCT 1 cut(s) 394
AluI AGCT 1 cut(s) 394
Alw26I GTCTC 1 cut(s) 372
AlwI GGATC 1 cut(s) 426
ApoI RAATTY 1 cut(s) 200
AsuHPI GGTGA 1 cut(s) 292
BarI GAAGNNNNNNTAC 2 cut(s) 146, 178
BccI CCATC 1 cut(s) 244
BciVI GTATCC 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 372
BfuI GTATCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 213
BmsI GCATC 2 cut(s) 291, 328
Bsc4I CCNNNNNNNGG 1 cut(s) 415
Bse3DI GCAATG 2 cut(s) 114, 357
BseLI CCNNNNNNNGG 1 cut(s) 415
BseMI GCAATG 2 cut(s) 114, 357
BseMII CTCAG 4 cut(s) 199, 231, 318, 324
BseRI GAGGAG 2 cut(s) 236, 239
BslI CCNNNNNNNGG 1 cut(s) 415
BsmAI GTCTC 1 cut(s) 372
Bsp143I GATC 2 cut(s) 319, 418
BspCNI CTCAG 4 cut(s) 198, 232, 319, 323
BspLI GGNNCC 1 cut(s) 213
BspPI GGATC 1 cut(s) 426
BsrDI GCAATG 2 cut(s) 114, 357
BssMI GATC 2 cut(s) 319, 418
BstC8I GCNNGC 1 cut(s) 237
BstDEI CTNAG 5 cut(s) 185, 240, 310, 327, 435
BstKTI GATC 2 cut(s) 322, 421
BstMAI GTCTC 1 cut(s) 372
BstMBI GATC 2 cut(s) 319, 418
BstMWI GCNNNNNNNGC 2 cut(s) 155, 347
BstNSI RCATGY 1 cut(s) 239
BstX2I RGATCY 1 cut(s) 418
BstYI RGATCY 1 cut(s) 418
BsuI GTATCC 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 237
Csp6I GTAC 2 cut(s) 124, 142
CviAII CATG 5 cut(s) 146, 151, 236, 323, 410
CviJI RGCY 1 cut(s) 394
CviKI_1 RGCY 1 cut(s) 394
CviQI GTAC 2 cut(s) 124, 142
DdeI CTNAG 5 cut(s) 185, 240, 310, 327, 435
DpnI GATC 2 cut(s) 321, 420
DpnII GATC 2 cut(s) 319, 418
Eco57I CTGAAG 1 cut(s) 392
FaeI CATG 5 cut(s) 149, 154, 239, 326, 413
FatI CATG 5 cut(s) 145, 150, 235, 322, 409
Hin1II CATG 5 cut(s) 149, 154, 239, 326, 413
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 292
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 313, 372
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 270, 325
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 3 cut(s) 350, 362, 406
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 347
HpyF3I CTNAG 5 cut(s) 185, 240, 310, 327, 435
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 5 cut(s) 149, 154, 239, 326, 413
Kzo9I GATC 2 cut(s) 319, 418
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 3 cut(s) 154, 172, 272
LweI GCATC 2 cut(s) 291, 328
MaeII ACGT 1 cut(s) 129
MalI GATC 2 cut(s) 321, 420
MboI GATC 2 cut(s) 319, 418
MboII GAAGA 1 cut(s) 385
MflI RGATCY 1 cut(s) 418
MluCI AATT 4 cut(s) 6, 200, 245, 284
MnlI CCTC 4 cut(s) 214, 217, 220, 315
MseI TTAA 1 cut(s) 30
MwoI GCNNNNNNNGC 2 cut(s) 155, 347
NdeII GATC 2 cut(s) 319, 418
NlaIII CATG 5 cut(s) 149, 154, 239, 326, 413
NlaIV GGNNCC 1 cut(s) 213
NspI RCATGY 1 cut(s) 239
PaeI GCATGC 1 cut(s) 239
PfeI GAWTC 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 213
PsuI RGATCY 1 cut(s) 418
RsaI GTAC 2 cut(s) 125, 143
RsaNI GTAC 2 cut(s) 124, 142
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 2 cut(s) 319, 418
SetI ASST 2 cut(s) 132, 396
SfaNI GCATC 2 cut(s) 291, 328
SphI GCATGC 1 cut(s) 239
Sse9I AATT 4 cut(s) 6, 200, 245, 284
SspI AATATT 1 cut(s) 83
TaiI ACGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 318
TasI AATT 4 cut(s) 6, 200, 245, 284
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TspDTI ATGAA 1 cut(s) 402
XapI RAATTY 1 cut(s) 200
XceI RCATGY 1 cut(s) 239
XcmI CCANNNNNNNNNTGG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.