RchiOBHm_Chr5g0066621

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
72731638 .. 72732300
663 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 597 bp
ATGAATGAGTTAAAACTTATAGCCAAGCTTCAACATACAAATCTTGTTAAGCTCCTGGGTTGCTGTATTGCAGAGGAGGAATTGATTATATTGATCTACGAGTACATGCCCACTCGAAGTTTGGACAAATTTTTTCATTCTTCATCGTTTGTCCAATCAGATCCATCTGAAAACACAAGATTGGATTGGAGTAAACATTTTCAAATCATAGAGGGTATTGCTCAAGGGGTACTTTACATCCACAAGCACTCCAGATTGAAAATCATTCATAGGGATCTAAAAGCTAGTAATGTCTTGTTAGATGGAGAAATGAATCCCAAAATTTCCGACTTTGAAATGGCAAAGATATTCGACATGAATCAAATCAAAGCAAACACCAATAGGGTTGTTGGAACAAAGTATGTATTTGTCGCACATGATTTCAATCATTTATATATCATGAAATCACTAATATTTCTCATTTCTCTACCATTGATTCATGTAGCGGTTACATGTCTCATGAGTATGCACGTTATGGCCATTTCTCTGAGAAATTGGATGTGTTCAGCTGTTGGAGATTATAAGTGGAAAAAACAATGGTACTTTCCATCATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

198

Amino Acids

23.04

Weight (kDa)

8.75

Isoelectric Point (pI)

38.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 133 1.7e-23 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 1 - 133 2.4e-21 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 561
AciI CCGC 1 cut(s) 485
AclWI GGATC 2 cut(s) 155, 282
AcoI YGGCCR 1 cut(s) 516
AcsI RAATTY 2 cut(s) 128, 321
AfaI GTAC 3 cut(s) 104, 231, 581
AflIII ACRYGT 1 cut(s) 491
AgsI TTSAA 5 cut(s) 32, 203, 259, 335, 424
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 4 cut(s) 28, 52, 284, 548
AluI AGCT 4 cut(s) 28, 52, 284, 548
Alw26I GTCTC 1 cut(s) 500
AlwI GGATC 2 cut(s) 155, 282
AoxI GGCC 1 cut(s) 516
ApoI RAATTY 2 cut(s) 128, 321
BalI TGGCCA 1 cut(s) 518
BccI CCATC 3 cut(s) 172, 296, 595
BciT130I CCWGG 1 cut(s) 56
BcoDI GTCTC 1 cut(s) 500
BfaI CTAG 1 cut(s) 285
Bme1390I CCNGG 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 235
BpuEI CTTGAG 1 cut(s) 207
BsaBI GATNNNNATC 1 cut(s) 423
BsaJI CCNNGG 1 cut(s) 55
BsaXI ACNNNNNCTCC 2 cut(s) 233, 263
Bse8I GATNNNNATC 1 cut(s) 423
BseBI CCWGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 55
BseGI GGATG 2 cut(s) 237, 543
BseJI GATNNNNATC 1 cut(s) 423
BseMII CTCAG 1 cut(s) 518
BseRI GAGGAG 1 cut(s) 89
BshFI GGCC 1 cut(s) 518
BsmAI GTCTC 1 cut(s) 500
BsnI GGCC 1 cut(s) 518
Bsp143I GATC 3 cut(s) 93, 160, 274
BspACI CCGC 1 cut(s) 485
BspANI GGCC 1 cut(s) 518
BspCNI CTCAG 1 cut(s) 519
BspHI TCATGA 2 cut(s) 438, 498
BspPI GGATC 2 cut(s) 155, 282
BssECI CCNNGG 1 cut(s) 55
BssMI GATC 3 cut(s) 93, 160, 274
Bst2UI CCWGG 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 527
BstF5I GGATG 2 cut(s) 237, 543
BstKTI GATC 3 cut(s) 96, 163, 277
BstMAI GTCTC 1 cut(s) 500
BstMBI GATC 3 cut(s) 93, 160, 274
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 2 cut(s) 109, 495
BstSCI CCNGG 1 cut(s) 54
BstX2I RGATCY 2 cut(s) 160, 274
BstYI RGATCY 2 cut(s) 160, 274
BsuRI GGCC 1 cut(s) 518
BtsCI GGATG 2 cut(s) 237, 543
CciI TCATGA 2 cut(s) 438, 498
Csp6I GTAC 3 cut(s) 103, 230, 580
CviAII CATG 8 cut(s) 106, 355, 416, 439, 479, 492, 499, 591
CviJI RGCY 6 cut(s) 23, 28, 52, 284, 518, 548
CviKI_1 RGCY 6 cut(s) 23, 28, 52, 284, 518, 548
CviQI GTAC 3 cut(s) 103, 230, 580
DdeI CTNAG 1 cut(s) 527
DpnI GATC 3 cut(s) 95, 162, 276
DpnII GATC 3 cut(s) 93, 160, 274
EaeI YGGCCR 1 cut(s) 516
EcoRII CCWGG 1 cut(s) 54
FaeI CATG 8 cut(s) 109, 358, 419, 442, 482, 495, 502, 594
FalI AAGNNNNNCTT 2 cut(s) 216, 248
FatI CATG 8 cut(s) 105, 354, 415, 438, 478, 491, 498, 590
FokI GGATG 2 cut(s) 224, 550
FspBI CTAG 1 cut(s) 285
GsuI CTGGAG 1 cut(s) 235
HaeIII GGCC 1 cut(s) 518
Hin1II CATG 8 cut(s) 109, 358, 419, 442, 482, 495, 502, 594
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 3 cut(s) 313, 358, 475
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 4 cut(s) 160, 169, 328, 528
Hpy188III TCNNGA 3 cut(s) 252, 439, 499
Hpy8I GTNNAC 1 cut(s) 194
HpyCH4IV ACGT 1 cut(s) 510
HpyCH4V TGCA 2 cut(s) 71, 508
HpyF3I CTNAG 1 cut(s) 527
HpySE526I ACGT 1 cut(s) 510
Hsp92II CATG 8 cut(s) 109, 358, 419, 442, 482, 495, 502, 594
Kzo9I GATC 3 cut(s) 93, 160, 274
LmnI GCTCC 1 cut(s) 57
LpnPI CCDG 3 cut(s) 41, 68, 265
MaeI CTAG 1 cut(s) 285
MaeII ACGT 1 cut(s) 510
MaeIII GTNAC 1 cut(s) 487
MalI GATC 3 cut(s) 95, 162, 276
MboI GATC 3 cut(s) 93, 160, 274
MboII GAAGA 1 cut(s) 132
MflI RGATCY 2 cut(s) 160, 274
MlsI TGGCCA 1 cut(s) 518
MluCI AATT 4 cut(s) 80, 128, 321, 532
MluNI TGGCCA 1 cut(s) 518
MmeI TCCRAC 3 cut(s) 351, 370, 532
MnlI CCTC 3 cut(s) 67, 70, 205
Mox20I TGGCCA 1 cut(s) 518
MscI TGGCCA 1 cut(s) 518
MseI TTAA 2 cut(s) 11, 48
MslI CAYNNNNRTG 1 cut(s) 503
Msp20I TGGCCA 1 cut(s) 518
MspA1I CMGCKG 1 cut(s) 548
MspR9I CCNGG 1 cut(s) 56
MvaI CCWGG 1 cut(s) 56
NdeII GATC 3 cut(s) 93, 160, 274
NlaIII CATG 8 cut(s) 109, 358, 419, 442, 482, 495, 502, 594
NspI RCATGY 2 cut(s) 109, 495
PagI TCATGA 2 cut(s) 438, 498
PciI ACATGT 1 cut(s) 491
PfeI GAWTC 3 cut(s) 313, 358, 475
PscI ACATGT 1 cut(s) 491
PsiI TTATAA 1 cut(s) 561
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
PsuI RGATCY 2 cut(s) 160, 274
PvuII CAGCTG 1 cut(s) 548
RsaI GTAC 3 cut(s) 104, 231, 581
RsaNI GTAC 3 cut(s) 103, 230, 580
RseI CAYNNNNRTG 1 cut(s) 503
SaqAI TTAA 2 cut(s) 11, 48
Sau3AI GATC 3 cut(s) 93, 160, 274
ScrFI CCNGG 1 cut(s) 56
SetI ASST 5 cut(s) 30, 54, 286, 513, 550
SmiMI CAYNNNNRTG 1 cut(s) 503
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
Sse9I AATT 4 cut(s) 80, 128, 321, 532
SsiI CCGC 1 cut(s) 485
SspI AATATT 1 cut(s) 453
SspMI CTAG 1 cut(s) 285
StyD4I CCNGG 1 cut(s) 54
TaiI ACGT 1 cut(s) 513
TaqI TCGA 2 cut(s) 115, 351
TasI AATT 4 cut(s) 80, 128, 321, 532
TatI WGTACW 1 cut(s) 102
TfiI GAWTC 3 cut(s) 313, 358, 475
Tru1I TTAA 2 cut(s) 11, 48
Tru9I TTAA 2 cut(s) 11, 48
TspDTI ATGAA 8 cut(s) 17, 125, 132, 257, 326, 371, 455, 467
XapI RAATTY 2 cut(s) 128, 321
XceI RCATGY 2 cut(s) 109, 495
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.