RchiOBHm_Chr5g0074131

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
80167456 .. 80167818
363 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34896

Sequence Viewer

Length: 261 bp
ATGAATGAGTTAGAGCTTATAGCCAAGCTTCAACAGACGAATCTTGTTAGGCTGTTCGGTTGCTGTGTTGAAGAGGAATTGATATTGATCTACGAGTACATGCCCCATATAAGTTTGGACGAACTTTTGTTTGATCCATCTGTAAACACAAAATTGGATTGGAGTAAACACTTCCAAATTTTGAAAGGAATTGCTCAAGGGGTACTTTACATCCACAAGCACTCCAGATTGAAAATCATTTTACAGGGATCTAAAAGCTAG

Protein Analysis

86

Amino Acids

10.0

Weight (kDa)

6.39

Isoelectric Point (pI)

46.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 75 5.6e-11 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 1 - 75 1.1e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 128, 256
AcsI RAATTY 1 cut(s) 177
AfaI GTAC 2 cut(s) 98, 204
AgsI TTSAA 4 cut(s) 32, 71, 184, 232
AluBI AGCT 3 cut(s) 16, 28, 258
AluI AGCT 3 cut(s) 16, 28, 258
AlwI GGATC 2 cut(s) 128, 256
ApoI RAATTY 1 cut(s) 177
BccI CCATC 1 cut(s) 145
BfaI CTAG 1 cut(s) 259
BpmI CTGGAG 1 cut(s) 208
BpuEI CTTGAG 1 cut(s) 180
BsaBI GATNNNNATC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bse8I GATNNNNATC 1 cut(s) 86
BseGI GGATG 1 cut(s) 210
BseJI GATNNNNATC 1 cut(s) 86
Bsp143I GATC 3 cut(s) 87, 133, 248
BspPI GGATC 2 cut(s) 128, 256
BssMI GATC 3 cut(s) 87, 133, 248
Bst6I CTCTTC 1 cut(s) 66
BstF5I GGATG 1 cut(s) 210
BstKTI GATC 3 cut(s) 90, 136, 251
BstMBI GATC 3 cut(s) 87, 133, 248
BstNSI RCATGY 1 cut(s) 103
BstX2I RGATCY 1 cut(s) 248
BstYI RGATCY 1 cut(s) 248
BtsCI GGATG 1 cut(s) 210
Csp6I GTAC 2 cut(s) 97, 203
CviAII CATG 1 cut(s) 100
CviJI RGCY 5 cut(s) 16, 23, 28, 52, 258
CviKI_1 RGCY 5 cut(s) 16, 23, 28, 52, 258
CviQI GTAC 2 cut(s) 97, 203
DpnI GATC 3 cut(s) 89, 135, 250
DpnII GATC 3 cut(s) 87, 133, 248
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
FaeI CATG 1 cut(s) 103
FaiI YATR 4 cut(s) 20, 101, 108, 110
FalI AAGNNNNNCTT 2 cut(s) 189, 221
FatI CATG 1 cut(s) 99
FokI GGATG 1 cut(s) 197
FspBI CTAG 1 cut(s) 259
GsuI CTGGAG 1 cut(s) 208
Hin1II CATG 1 cut(s) 103
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 1 cut(s) 40
Hpy166II GTNNAC 2 cut(s) 145, 167
Hpy188III TCNNGA 1 cut(s) 225
Hpy8I GTNNAC 2 cut(s) 145, 167
Hsp92II CATG 1 cut(s) 103
Kzo9I GATC 3 cut(s) 87, 133, 248
LpnPI CCDG 2 cut(s) 230, 238
MaeI CTAG 1 cut(s) 259
MalI GATC 3 cut(s) 89, 135, 250
MboI GATC 3 cut(s) 87, 133, 248
MboII GAAGA 1 cut(s) 83
MflI RGATCY 1 cut(s) 248
MluCI AATT 4 cut(s) 77, 152, 177, 189
MnlI CCTC 1 cut(s) 67
NdeII GATC 3 cut(s) 87, 133, 248
NlaIII CATG 1 cut(s) 103
NspI RCATGY 1 cut(s) 103
PfeI GAWTC 1 cut(s) 40
PsuI RGATCY 1 cut(s) 248
RsaI GTAC 2 cut(s) 98, 204
RsaNI GTAC 2 cut(s) 97, 203
Sau3AI GATC 3 cut(s) 87, 133, 248
SetI ASST 3 cut(s) 18, 30, 260
SgeI CNNG 8 cut(s) 37, 56, 106, 112, 209, 229, 237, 257
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
Sse9I AATT 4 cut(s) 77, 152, 177, 189
SspMI CTAG 1 cut(s) 259
TasI AATT 4 cut(s) 77, 152, 177, 189
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 177
XceI RCATGY 1 cut(s) 103
XspI CTAG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.