RchiOBHm_Chr5g0066651

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
72741060 .. 72741521
462 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34240

Sequence Viewer

Length: 363 bp
ATGAATGAGTTAAAACTTATAGCCAAGCTTCAACATACAAATCTTCTTAGGCTCTTGAGTTGCTGTATTGAAGAGGAGGAATTGATATTGATCTATGATCATTCTTCATTGTTTGTCCAATCAGATCCATCTGAAAACATAAGATTGGATTGGAGTAAACGTTTTCAAATCTTAGAGGGTATTGCTCAAGGGGTATTTTATATCCACAAGTACTCCAGATTGAAGATCTTTCATAGGGATCTAAAAGCTAGTAATGTTTTGTCAGATGGACAAATGAATCCCAAAATTTTCGACTTTGAAATGGCAATGATTTTCAACATGAATCAAACCAAAGAAAACACCAACAGGGTTGTTGGAACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

120

Amino Acids

14.08

Weight (kDa)

6.41

Isoelectric Point (pI)

45.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 120 1.1e-16 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 1 - 113 7.2e-13 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 160
AclWI GGATC 2 cut(s) 119, 246
AcsI RAATTY 1 cut(s) 285
AfaI GTAC 1 cut(s) 212
AgsI TTSAA 6 cut(s) 32, 71, 167, 223, 299, 316
AluBI AGCT 2 cut(s) 28, 248
AluI AGCT 2 cut(s) 28, 248
AlwI GGATC 2 cut(s) 119, 246
ApoI RAATTY 1 cut(s) 285
BccI CCATC 2 cut(s) 136, 260
BclI TGATCA 1 cut(s) 97
BfaI CTAG 1 cut(s) 249
BglII AGATCT 1 cut(s) 225
BmcAI AGTACT 1 cut(s) 212
BpmI CTGGAG 1 cut(s) 199
BpuEI CTTGAG 2 cut(s) 76, 171
BsaBI GATNNNNATC 1 cut(s) 89
BsaXI ACNNNNNCTCC 4 cut(s) 145, 175, 197, 227
Bse3DI GCAATG 1 cut(s) 312
Bse8I GATNNNNATC 1 cut(s) 89
BseJI GATNNNNATC 1 cut(s) 89
BseMI GCAATG 1 cut(s) 312
BseRI GAGGAG 1 cut(s) 89
Bsp143I GATC 5 cut(s) 90, 97, 124, 225, 238
BspPI GGATC 2 cut(s) 119, 246
BsrDI GCAATG 1 cut(s) 312
BssMI GATC 5 cut(s) 90, 97, 124, 225, 238
Bst6I CTCTTC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 47, 172
BstKTI GATC 5 cut(s) 93, 100, 127, 228, 241
BstMBI GATC 5 cut(s) 90, 97, 124, 225, 238
BstX2I RGATCY 3 cut(s) 124, 225, 238
BstYI RGATCY 3 cut(s) 124, 225, 238
Csp6I GTAC 1 cut(s) 211
CviAII CATG 1 cut(s) 319
CviJI RGCY 4 cut(s) 23, 28, 52, 248
CviKI_1 RGCY 4 cut(s) 23, 28, 52, 248
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 2 cut(s) 47, 172
DpnI GATC 5 cut(s) 92, 99, 126, 227, 240
DpnII GATC 5 cut(s) 90, 97, 124, 225, 238
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
FaeI CATG 1 cut(s) 322
FaiI YATR 7 cut(s) 20, 36, 96, 140, 201, 234, 320
FatI CATG 1 cut(s) 318
FbaI TGATCA 1 cut(s) 97
FspBI CTAG 1 cut(s) 249
GsuI CTGGAG 1 cut(s) 199
Hin1II CATG 1 cut(s) 322
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 2 cut(s) 277, 322
Hpy166II GTNNAC 1 cut(s) 158
Hpy188I TCNGA 3 cut(s) 124, 133, 265
Hpy188III TCNNGA 2 cut(s) 55, 216
Hpy8I GTNNAC 1 cut(s) 158
HpyCH4IV ACGT 2 cut(s) 160, 359
HpyF3I CTNAG 2 cut(s) 47, 172
HpySE526I ACGT 2 cut(s) 160, 359
Hsp92II CATG 1 cut(s) 322
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 5 cut(s) 90, 97, 124, 225, 238
LpnPI CCDG 2 cut(s) 229, 331
MaeI CTAG 1 cut(s) 249
MaeII ACGT 2 cut(s) 160, 359
MalI GATC 5 cut(s) 92, 99, 126, 227, 240
MboI GATC 5 cut(s) 90, 97, 124, 225, 238
MboII GAAGA 4 cut(s) 35, 83, 96, 235
MflI RGATCY 3 cut(s) 124, 225, 238
MluCI AATT 2 cut(s) 80, 285
MmeI TCCRAC 1 cut(s) 334
MnlI CCTC 3 cut(s) 67, 70, 169
MseI TTAA 1 cut(s) 11
NdeII GATC 5 cut(s) 90, 97, 124, 225, 238
NlaIII CATG 1 cut(s) 322
PfeI GAWTC 2 cut(s) 277, 322
Psp1406I AACGTT 1 cut(s) 160
PsuI RGATCY 3 cut(s) 124, 225, 238
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
SaqAI TTAA 1 cut(s) 11
Sau3AI GATC 5 cut(s) 90, 97, 124, 225, 238
ScaI AGTACT 1 cut(s) 212
SetI ASST 4 cut(s) 30, 163, 250, 362
SgeI CNNG 8 cut(s) 37, 67, 200, 220, 228, 261, 331, 358
SmlI CTYRAG 2 cut(s) 55, 186
SmoI CTYRAG 2 cut(s) 55, 186
Sse9I AATT 2 cut(s) 80, 285
SspMI CTAG 1 cut(s) 249
TaiI ACGT 2 cut(s) 163, 362
TaqI TCGA 1 cut(s) 291
TasI AATT 2 cut(s) 80, 285
TatI WGTACW 1 cut(s) 210
TfiI GAWTC 2 cut(s) 277, 322
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TspDTI ATGAA 5 cut(s) 17, 96, 221, 290, 335
XapI RAATTY 1 cut(s) 285
XspI CTAG 1 cut(s) 249
ZrmI AGTACT 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.