Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020548

Physical Location & Seq

Genomic Coordinates Reverse (-)

82470303 .. 82470609

Gene Structure 307 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGAGAAATTGTGCCTTCGTGGATTTCCAACATGAAGGCTTGGCTTACCAAGCACAGCGTCAGTTGAATGGGCTGAGGTTTCTTGGGAAGGTGTTAAAAGTGGAGAGGGCTACTAGCAATAGTGGTAAGCCATTGCAGGATGGCAAGAAGGATTCGGTTTCTGTGCCTCCCACTTCCACATCATCTTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000375 GO:0000377 GO:0000398 GO:0003006 GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005681 GO:0005689 GO:0006139 GO:0006396 GO:0006397 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0008380 GO:0009791 GO:0009987 GO:0010229 GO:0010467 GO:0016070 GO:0016071 GO:0017069 GO:0022414 GO:0030626 GO:0032501 GO:0032502 GO:0032991 GO:0034641 GO:0036002 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046483 GO:0048367 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071704 GO:0090304 GO:0090567 GO:0097157 GO:0097159 GO:1901360 GO:1901363 GO:1990904

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RRM_1

Protein Analysis

63

Amino Acids

6.88

Weight (kDa)

9.74

Isoelectric Point (pI)

24.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020548)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0076741
rosa_laevigata	RLG00000001026 RLG00000014765
rosa_samantha	Rh2DG322500 Rh5AG241600 Rh5CG272900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	67
BbvCI	CCTCAGC	1 cut(s)	74
BccI	CCATC	1 cut(s)	134
BfaI	CTAG	1 cut(s)	114
Bpu10I	CCTNAGC	1 cut(s)	74
Bse3DI	GCAATG	1 cut(s)	131
BseGI	GGATG	1 cut(s)	145
BseMI	GCAATG	1 cut(s)	131
BseMII	CTCAG	1 cut(s)	65
BspCNI	CTCAG	1 cut(s)	66
BsrDI	GCAATG	1 cut(s)	131
BstDEI	CTNAG	1 cut(s)	74
BstF5I	GGATG	1 cut(s)	145
BstMWI	GCNNNNNNNGC	1 cut(s)	50
BtsCI	GGATG	1 cut(s)	145
CseI	GACGC	1 cut(s)	47
CviAII	CATG	1 cut(s)	32
CviJI	RGCY	5 cut(s)	39, 44, 73, 110, 130
CviKI_1	RGCY	5 cut(s)	39, 44, 73, 110, 130
DdeI	CTNAG	1 cut(s)	74
FaeI	CATG	1 cut(s)	35
FaiI	YATR	1 cut(s)	33
FatI	CATG	1 cut(s)	31
FokI	GGATG	1 cut(s)	152
FspBI	CTAG	1 cut(s)	114
HgaI	GACGC	1 cut(s)	47
Hin1II	CATG	1 cut(s)	35
HinfI	GANTC	1 cut(s)	152
Hpy188III	TCNNGA	1 cut(s)	189
HpyAV	CCTTC	4 cut(s)	25, 29, 82, 142
HpyCH4V	TGCA	1 cut(s)	136
HpyF10VI	GCNNNNNNNGC	1 cut(s)	50
HpyF3I	CTNAG	1 cut(s)	74
Hsp92II	CATG	1 cut(s)	35
LpnPI	CCDG	1 cut(s)	122
MaeI	CTAG	1 cut(s)	114
MboII	GAAGA	1 cut(s)	177
MluCI	AATT	1 cut(s)	7
MmeI	TCCRAC	1 cut(s)	52
MnlI	CCTC	3 cut(s)	69, 99, 177
MseI	TTAA	1 cut(s)	95
MwoI	GCNNNNNNNGC	1 cut(s)	50
NlaIII	CATG	1 cut(s)	35
PfeI	GAWTC	1 cut(s)	152
SaqAI	TTAA	1 cut(s)	95
SetI	ASST	2 cut(s)	80, 93
SgeI	CNNG	8 cut(s)	31, 44, 52, 62, 95, 126, 149, 157
Sse9I	AATT	1 cut(s)	7
SspMI	CTAG	1 cut(s)	114
TasI	AATT	1 cut(s)	7
TfiI	GAWTC	1 cut(s)	152
Tru1I	TTAA	1 cut(s)	95
Tru9I	TTAA	1 cut(s)	95
TspDTI	ATGAA	1 cut(s)	48
XspI	CTAG	1 cut(s)	114

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.