RchiOBHm_Chr5g0076741

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82470303 .. 82470609
307 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGAGAAATTGTGCCTTCGTGGATTTCCAACATGAAGGCTTGGCTTACCAAGCACAGCGTCAGTTGAATGGGCTGAGGTTTCTTGGGAAGGTGTTAAAAGTGGAGAGGGCTACTAGCAATAGTGGTAAGCCATTGCAGGATGGCAAGAAGGATTCGGTTTCTGTGCCTCCCACTTCCACATCATCTTCCTGA

Protein Analysis

63

Amino Acids

6.88

Weight (kDa)

9.74

Isoelectric Point (pI)

24.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020548)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0076741
rosa_laevigata RLG00000001026 RLG00000014765
rosa_samantha Rh2DG322500 Rh5AG241600 Rh5CG272900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 67
BbvCI CCTCAGC 1 cut(s) 74
BccI CCATC 1 cut(s) 134
BfaI CTAG 1 cut(s) 114
Bpu10I CCTNAGC 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 131
BseGI GGATG 1 cut(s) 145
BseMI GCAATG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 66
BsrDI GCAATG 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 145
CseI GACGC 1 cut(s) 47
CviAII CATG 1 cut(s) 32
CviJI RGCY 5 cut(s) 39, 44, 73, 110, 130
CviKI_1 RGCY 5 cut(s) 39, 44, 73, 110, 130
DdeI CTNAG 1 cut(s) 74
FaeI CATG 1 cut(s) 35
FaiI YATR 1 cut(s) 33
FatI CATG 1 cut(s) 31
FokI GGATG 1 cut(s) 152
FspBI CTAG 1 cut(s) 114
HgaI GACGC 1 cut(s) 47
Hin1II CATG 1 cut(s) 35
HinfI GANTC 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 189
HpyAV CCTTC 4 cut(s) 25, 29, 82, 142
HpyCH4V TGCA 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 1 cut(s) 35
LpnPI CCDG 1 cut(s) 122
MaeI CTAG 1 cut(s) 114
MboII GAAGA 1 cut(s) 177
MluCI AATT 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 3 cut(s) 69, 99, 177
MseI TTAA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 50
NlaIII CATG 1 cut(s) 35
PfeI GAWTC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 95
SetI ASST 2 cut(s) 80, 93
SgeI CNNG 8 cut(s) 31, 44, 52, 62, 95, 126, 149, 157
Sse9I AATT 1 cut(s) 7
SspMI CTAG 1 cut(s) 114
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 48
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.