RchiOBHm_Chr3g0496421

Belongs to the glycosyl hydrolase 13 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
47220145 .. 47220762
618 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGACGTTACTTGGGCTCTCTCTCTCTCTCTCTCACACACACACACACACAACTGCATTTGACTTCACAACCAAGGGAGTTCTTCAGGAAGCTGTCAAGGGACAATTATGGAGCTTACGTGATCCCCAGGGGAAGCCACCAGGTGTAATGCACTAG

Protein Analysis

51

Amino Acids

5.57

Weight (kDa)

8.33

Isoelectric Point (pI)

36.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 68
AdeI CACNNNGTG 1 cut(s) 143
AjnI CCWGG 2 cut(s) 126, 139
AluBI AGCT 2 cut(s) 92, 114
AluI AGCT 2 cut(s) 92, 114
AlwI GGATC 1 cut(s) 116
BanII GRGCYC 1 cut(s) 18
BciT130I CCWGG 2 cut(s) 128, 141
BfaI CTAG 1 cut(s) 154
Bme1390I CCNGG 2 cut(s) 128, 141
BmrFI CCNGG 2 cut(s) 128, 141
BsaAI YACGTR 1 cut(s) 119
BsaJI CCNNGG 3 cut(s) 72, 126, 127
BsaXI ACNNNNNCTCC 2 cut(s) 103, 133
BseBI CCWGG 2 cut(s) 128, 141
BseDI CCNNGG 3 cut(s) 72, 126, 127
BslFI GGGAC 1 cut(s) 114
BsmFI GGGAC 1 cut(s) 114
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 121
BspPI GGATC 1 cut(s) 116
BssECI CCNNGG 3 cut(s) 72, 126, 127
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 2 cut(s) 128, 141
BstBAI YACGTR 1 cut(s) 119
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstNI CCWGG 2 cut(s) 128, 141
BstSCI CCNGG 2 cut(s) 126, 139
CsiI ACCWGGT 1 cut(s) 139
CviJI RGCY 4 cut(s) 16, 92, 114, 136
CviKI_1 RGCY 4 cut(s) 16, 92, 114, 136
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
DraIII CACNNNGTG 1 cut(s) 143
Eco130I CCWWGG 1 cut(s) 72
Eco24I GRGCYC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 68
EcoRII CCWGG 2 cut(s) 126, 139
EcoT14I CCWWGG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 72
FaiI YATR 1 cut(s) 109
FaqI GGGAC 1 cut(s) 114
FriOI GRGCYC 1 cut(s) 18
FspBI CTAG 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 86
HpyCH4IV ACGT 2 cut(s) 5, 118
HpyCH4V TGCA 2 cut(s) 56, 151
HpySE526I ACGT 2 cut(s) 5, 118
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 4 cut(s) 71, 113, 126, 140
MabI ACCWGGT 1 cut(s) 139
MaeI CTAG 1 cut(s) 154
MaeII ACGT 2 cut(s) 5, 118
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 1 cut(s) 104
MspR9I CCNGG 2 cut(s) 128, 141
MvaI CCWGG 2 cut(s) 128, 141
NdeII GATC 1 cut(s) 121
PasI CCCWGGG 1 cut(s) 127
Ppu21I YACGTR 1 cut(s) 119
Psp6I CCWGG 2 cut(s) 126, 139
PspGI CCWGG 2 cut(s) 126, 139
Sau3AI GATC 1 cut(s) 121
ScrFI CCNGG 2 cut(s) 128, 141
SduI GDGCHC 1 cut(s) 18
SetI ASST 5 cut(s) 8, 94, 116, 121, 145
SexAI ACCWGGT 1 cut(s) 139
SgeI CNNG 8 cut(s) 23, 85, 98, 109, 131, 139, 140, 152
Sse9I AATT 1 cut(s) 104
SspMI CTAG 1 cut(s) 154
StyD4I CCNGG 2 cut(s) 126, 139
StyI CCWWGG 1 cut(s) 72
TaiI ACGT 2 cut(s) 8, 121
TasI AATT 1 cut(s) 104
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.