RchiOBHm_Chr2g0089271

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
3505702 .. 3506192
491 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGCATCGATCATCGAGCACTACGCGAGCCTCCGAGGAGTTCTTGGTGAACTTTTCGCCTGCGTCCTTGTCTCTAAGCTCTCCGCTTCTGAATACTACAGCAGTCGCTTCTCTGGATGACTTGCCTGTGTATGATACAAATTCTGATCACGTTACCAAAAAAGAAATTGGTATGCATCATCACAATCCTTTAGGAGAGAATGTCATTCACCTAATTCCCCTGGTTATATTTCTCTGTGGTTTTACACTTTGGATTTTCTCTCGTCCAGCTAAATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.19

Weight (kDa)

6.26

Isoelectric Point (pI)

62.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020268)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G20045
prunus_persica Prupe.7G238200_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0089271
rosa_samantha Rh2AG045000 Rh2CG044900 Rh2DG044000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 25
AciI CCGC 1 cut(s) 83
AcsI RAATTY 1 cut(s) 139
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 2 cut(s) 78, 269
AluI AGCT 2 cut(s) 78, 269
Alw21I GWGCWC 1 cut(s) 20
Alw26I GTCTC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 139
AsuHPI GGTGA 2 cut(s) 58, 200
Bbv12I GWGCWC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 221
BclI TGATCA 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 221
BmsI GCATC 2 cut(s) 13, 184
Bsa29I ATCGAT 1 cut(s) 7
BsaJI CCNNGG 2 cut(s) 33, 219
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
BseBI CCWGG 1 cut(s) 221
BseCI ATCGAT 1 cut(s) 7
BseDI CCNNGG 2 cut(s) 33, 219
BseGI GGATG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 50
Bsh1236I CGCG 1 cut(s) 25
BshVI ATCGAT 1 cut(s) 7
BsiHKAI GWGCWC 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 20
Bsp143I GATC 2 cut(s) 8, 145
BspACI CCGC 1 cut(s) 83
BspDI ATCGAT 1 cut(s) 7
BspFNI CGCG 1 cut(s) 25
BssECI CCNNGG 2 cut(s) 33, 219
BssMI GATC 2 cut(s) 8, 145
Bst2UI CCWGG 1 cut(s) 221
BstC8I GCNNGC 2 cut(s) 27, 60
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 121
BstFNI CGCG 1 cut(s) 25
BstKTI GATC 2 cut(s) 11, 148
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 2 cut(s) 8, 145
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 96
BstUI CGCG 1 cut(s) 25
Bsu15I ATCGAT 1 cut(s) 7
BsuTUI ATCGAT 1 cut(s) 7
BtsCI GGATG 1 cut(s) 121
Cac8I GCNNGC 2 cut(s) 27, 60
ClaI ATCGAT 1 cut(s) 7
CseI GACGC 1 cut(s) 51
CviJI RGCY 3 cut(s) 29, 78, 269
CviKI_1 RGCY 3 cut(s) 29, 78, 269
DdeI CTNAG 1 cut(s) 74
DpnI GATC 2 cut(s) 10, 147
DpnII GATC 2 cut(s) 8, 145
EcoRII CCWGG 1 cut(s) 219
EcoT22I ATGCAT 2 cut(s) 6, 177
FaiI YATR 3 cut(s) 132, 173, 227
FbaI TGATCA 1 cut(s) 145
FokI GGATG 1 cut(s) 128
HgaI GACGC 1 cut(s) 51
HphI GGTGA 2 cut(s) 58, 200
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 3 cut(s) 34, 90, 145
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 150
HpyCH4V TGCA 2 cut(s) 4, 175
HpyF3I CTNAG 1 cut(s) 74
HpySE526I ACGT 1 cut(s) 150
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 8, 145
LpnPI CCDG 5 cut(s) 72, 98, 138, 206, 233
LweI GCATC 2 cut(s) 13, 184
MaeII ACGT 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 151
MalI GATC 2 cut(s) 10, 147
MboI GATC 2 cut(s) 8, 145
MhlI GDGCHC 1 cut(s) 20
MluCI AATT 4 cut(s) 139, 165, 213, 272
MnlI CCTC 2 cut(s) 28, 40
Mph1103I ATGCAT 2 cut(s) 6, 177
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
MvnI CGCG 1 cut(s) 25
NdeII GATC 2 cut(s) 8, 145
NsiI ATGCAT 2 cut(s) 6, 177
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
Sau3AI GATC 2 cut(s) 8, 145
ScrFI CCNGG 1 cut(s) 221
SduI GDGCHC 1 cut(s) 20
SetI ASST 4 cut(s) 80, 153, 213, 271
SfaNI GCATC 2 cut(s) 13, 184
SfcI CTRYAG 1 cut(s) 96
Sse9I AATT 4 cut(s) 139, 165, 213, 272
SsiI CCGC 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 219
TaiI ACGT 1 cut(s) 153
TaqI TCGA 2 cut(s) 7, 14
TasI AATT 4 cut(s) 139, 165, 213, 272
XapI RAATTY 1 cut(s) 139
Zsp2I ATGCAT 2 cut(s) 6, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.