RchiOBHm_Chr2g0121901

chorismate mutase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
34760134 .. 34760973
840 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 441 bp
ATGTTGTTGGTTTGCTTGTACGTGGATGATTTAATTTTTACAGGCAATAATCCAAGAATGTTTGAAGATTTCATGAAAGCAATGATTAGAGAATTCGAGATGACTGATATTAGGCTCATGTCATACTATCTTGACATTGAAGTGAAGCAAATGGAAGAAGGCATCTTCATTTCACAAGAAGGCTATACAAGAGAAATCCTCAAAAAATTCAAGATGGATAAGTGCAATCCTGCAATCACACTTATGGAGTATGGAGTGAAGTTATCCAAGCATGATGTTGCTGAGAAGGTGAATCCAATTACTTTCAAGAGTTTGATTGGGAGTTTGAGATATCTAACATGTACTAGACCTGATATTCTTTATGGAGTTAGTCTTCTTAGCTGTTACATGGAGGAGCCAACTAGCACGCACATGAAGACAGCCACAAGAATTCTTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

17.07

Weight (kDa)

5.73

Isoelectric Point (pI)

36.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 2 - 82 9.6e-18 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019676)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g40202
rosa_chinensis RchiOBHm_Chr1g0369901 RchiOBHm_Chr2g0121901
rosa_laevigata RLG00000035900
rosa_roxburghii Rroxscaffold_3G00244770 Rroxscaffold_5G00337010
rosa_wichuraiana Rw2G023390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 92, 206, 429
AfaI GTAC 2 cut(s) 20, 343
AflIII ACRYGT 1 cut(s) 338
AgsI TTSAA 4 cut(s) 65, 140, 211, 307
AluBI AGCT 1 cut(s) 381
AluI AGCT 1 cut(s) 381
ApoI RAATTY 3 cut(s) 92, 206, 429
AsuHPI GGTGA 1 cut(s) 301
BbsI GAAGAC 2 cut(s) 365, 422
BccI CCATC 1 cut(s) 208
BfaI CTAG 2 cut(s) 345, 402
BmiI GGNNCC 1 cut(s) 396
BmsI GCATC 1 cut(s) 171
BpiI GAAGAC 2 cut(s) 365, 422
BplI GAGNNNNNCTC 2 cut(s) 183, 215
BsaAI YACGTR 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 87
BseGI GGATG 1 cut(s) 31
BseMI GCAATG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 273
BseRI GAGGAG 1 cut(s) 407
BspCNI CTCAG 1 cut(s) 274
BspHI TCATGA 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 396
BsrDI GCAATG 1 cut(s) 87
BstBAI YACGTR 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 407
BstDEI CTNAG 2 cut(s) 282, 377
BstF5I GGATG 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 342
BstV2I GAAGAC 2 cut(s) 365, 422
BtsCI GGATG 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 407
CciI TCATGA 1 cut(s) 72
Csp6I GTAC 2 cut(s) 19, 342
CviAII CATG 6 cut(s) 73, 118, 272, 339, 388, 412
CviJI RGCY 5 cut(s) 115, 183, 381, 397, 422
CviKI_1 RGCY 5 cut(s) 115, 183, 381, 397, 422
CviQI GTAC 2 cut(s) 19, 342
DdeI CTNAG 2 cut(s) 282, 377
Eco32I GATATC 1 cut(s) 332
EcoRI GAATTC 2 cut(s) 92, 429
EcoRV GATATC 1 cut(s) 332
FaeI CATG 6 cut(s) 76, 121, 275, 342, 391, 415
FatI CATG 6 cut(s) 72, 117, 271, 338, 387, 411
FokI GGATG 1 cut(s) 38
FspBI CTAG 2 cut(s) 345, 402
Hin1II CATG 6 cut(s) 76, 121, 275, 342, 391, 415
HinfI GANTC 1 cut(s) 292
HphI GGTGA 1 cut(s) 301
Hpy188III TCNNGA 5 cut(s) 73, 97, 131, 211, 307
HpyAV CCTTC 3 cut(s) 152, 173, 280
HpyCH4IV ACGT 1 cut(s) 21
HpyCH4V TGCA 2 cut(s) 225, 233
HpyF3I CTNAG 2 cut(s) 282, 377
HpySE526I ACGT 1 cut(s) 21
Hsp92II CATG 6 cut(s) 76, 121, 275, 342, 391, 415
LmnI GCTCC 1 cut(s) 394
LpnPI CCDG 3 cut(s) 27, 243, 363
LweI GCATC 1 cut(s) 171
MaeI CTAG 2 cut(s) 345, 402
MaeII ACGT 1 cut(s) 21
MaeIII GTNAC 1 cut(s) 383
MboII GAAGA 6 cut(s) 77, 157, 167, 365, 425, 427
MluCI AATT 5 cut(s) 33, 92, 206, 297, 429
MnlI CCTC 2 cut(s) 209, 385
MseI TTAA 1 cut(s) 32
MslI CAYNNNNRTG 3 cut(s) 140, 242, 410
NlaIII CATG 6 cut(s) 76, 121, 275, 342, 391, 415
NlaIV GGNNCC 1 cut(s) 396
NspI RCATGY 1 cut(s) 342
PagI TCATGA 1 cut(s) 72
PciI ACATGT 1 cut(s) 338
PfeI GAWTC 1 cut(s) 292
Ppu21I YACGTR 1 cut(s) 22
PscI ACATGT 1 cut(s) 338
PspN4I GGNNCC 1 cut(s) 396
RsaI GTAC 2 cut(s) 20, 343
RsaNI GTAC 2 cut(s) 19, 342
RseI CAYNNNNRTG 3 cut(s) 140, 242, 410
SaqAI TTAA 1 cut(s) 32
SetI ASST 4 cut(s) 24, 291, 352, 383
SfaNI GCATC 1 cut(s) 171
SmiMI CAYNNNNRTG 3 cut(s) 140, 242, 410
Sse9I AATT 5 cut(s) 33, 92, 206, 297, 429
SspMI CTAG 2 cut(s) 345, 402
TaiI ACGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 96
TasI AATT 5 cut(s) 33, 92, 206, 297, 429
TatI WGTACW 1 cut(s) 341
TfiI GAWTC 1 cut(s) 292
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TspDTI ATGAA 4 cut(s) 61, 89, 157, 428
XapI RAATTY 3 cut(s) 92, 206, 429
XceI RCATGY 1 cut(s) 342
XspI CTAG 2 cut(s) 345, 402
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.