Rroxscaffold_5G00337010

spliceosomal complex assembly

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0019676
Physical Location & Seq
Forward (+)
4982032 .. 4987029
4998 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00337010.1

Sequence Viewer

Length: 315 bp
ATGATTATTGCTCAAGTATATGTTGATGACATTGTCTTTGGATCTACATCTAAGCATCTAGTTCGGGAATTTCGATCAATCATGGAAAGTGAATTTGAAATGAGTATGTGTGGTGAACTAACGTTCTTTCTTGGTTTGCAAGTAAAACAACTTACCACAAGTTTATTTCTTTCCCAAACCAAATATGCTGAAAATCTGATCAAGAAAATTGGTCTTCAATCCAAGAAGACGGTCAACAATCCAATGAGCACCACTACAAAGTCGACCGAAGATCGGGATGGGAATTCGATTGACTCCACCCTTTACGAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 gag_pre-integrs rve zf-CCHC

Protein Analysis

104

Amino Acids

11.76

Weight (kDa)

5.33

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 2 - 82 2.5e-15 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019676)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g40202
rosa_chinensis RchiOBHm_Chr1g0369901 RchiOBHm_Chr2g0121901
rosa_laevigata RLG00000035900
rosa_roxburghii Rroxscaffold_3G00244770 Rroxscaffold_5G00337010
rosa_wichuraiana Rw2G023390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 263
AclI AACGTT 1 cut(s) 122
AclWI GGATC 1 cut(s) 49
AcsI RAATTY 3 cut(s) 68, 92, 283
AfiI CCNNNNNNNGG 1 cut(s) 273
AgsI TTSAA 2 cut(s) 98, 218
Alw21I GWGCWC 1 cut(s) 251
AlwI GGATC 1 cut(s) 49
ApoI RAATTY 3 cut(s) 68, 92, 283
ArsI GACNNNNNNTTYG 2 cut(s) 20, 52
AsuHPI GGTGA 1 cut(s) 125
BbsI GAAGAC 2 cut(s) 206, 233
Bbv12I GWGCWC 1 cut(s) 251
BccI CCATC 1 cut(s) 272
BcgI CGANNNNNNTGC 2 cut(s) 44, 78
BclI TGATCA 1 cut(s) 198
BfaI CTAG 1 cut(s) 59
BmsI GCATC 1 cut(s) 64
BpiI GAAGAC 2 cut(s) 206, 233
BsaBI GATNNNNATC 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 273
Bse8I GATNNNNATC 1 cut(s) 46
BseGI GGATG 1 cut(s) 283
BseJI GATNNNNATC 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 273
Bsh1285I CGRYCG 1 cut(s) 267
BsiEI CGRYCG 1 cut(s) 267
BsiHKAI GWGCWC 1 cut(s) 251
BslI CCNNNNNNNGG 1 cut(s) 273
Bsp1286I GDGCHC 1 cut(s) 251
Bsp143I GATC 4 cut(s) 41, 74, 198, 271
BspPI GGATC 1 cut(s) 49
BssMI GATC 4 cut(s) 41, 74, 198, 271
Bst4CI ACNGT 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 283
BstKTI GATC 4 cut(s) 44, 77, 201, 274
BstMBI GATC 4 cut(s) 41, 74, 198, 271
BstMCI CGRYCG 1 cut(s) 267
BstV2I GAAGAC 2 cut(s) 206, 233
BstX2I RGATCY 1 cut(s) 41
BstYI RGATCY 1 cut(s) 41
BtsCI GGATG 1 cut(s) 283
CviAII CATG 2 cut(s) 82, 312
DdeI CTNAG 1 cut(s) 51
DpnI GATC 4 cut(s) 43, 76, 200, 273
DpnII GATC 4 cut(s) 41, 74, 198, 271
EcoRI GAATTC 1 cut(s) 283
FaeI CATG 2 cut(s) 85, 315
FaiI YATR 6 cut(s) 19, 21, 83, 107, 186, 313
FatI CATG 2 cut(s) 81, 311
FbaI TGATCA 1 cut(s) 198
FblI GTMKAC 1 cut(s) 263
FokI GGATG 1 cut(s) 290
FspBI CTAG 1 cut(s) 59
Hin1II CATG 2 cut(s) 85, 315
HincII GTYRAC 2 cut(s) 235, 264
HindII GTYRAC 2 cut(s) 235, 264
HinfI GANTC 1 cut(s) 293
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 3 cut(s) 116, 235, 264
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 3 cut(s) 65, 202, 275
Hpy8I GTNNAC 3 cut(s) 116, 235, 264
HpyCH4III ACNGT 1 cut(s) 232
HpyCH4IV ACGT 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 139
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 122
Hsp92II CATG 2 cut(s) 85, 315
Ksp22I TGATCA 1 cut(s) 198
Kzo9I GATC 4 cut(s) 41, 74, 198, 271
LweI GCATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 59
MaeII ACGT 1 cut(s) 122
MalI GATC 4 cut(s) 43, 76, 200, 273
MboI GATC 4 cut(s) 41, 74, 198, 271
MboII GAAGA 3 cut(s) 206, 238, 281
MflI RGATCY 1 cut(s) 41
MhlI GDGCHC 1 cut(s) 251
MluCI AATT 4 cut(s) 68, 92, 207, 283
MlyI GAGTC 1 cut(s) 287
NdeII GATC 4 cut(s) 41, 74, 198, 271
NlaIII CATG 2 cut(s) 85, 315
PcsI WCGNNNNNNNCGW 1 cut(s) 70
PflFI GACNNNGTC 1 cut(s) 32
PleI GAGTC 1 cut(s) 287
PpsI GAGTC 1 cut(s) 287
Psp1406I AACGTT 1 cut(s) 122
PsuI RGATCY 1 cut(s) 41
PsyI GACNNNGTC 1 cut(s) 32
SalI GTCGAC 1 cut(s) 262
Sau3AI GATC 4 cut(s) 41, 74, 198, 271
SchI GAGTC 1 cut(s) 287
SduI GDGCHC 1 cut(s) 251
SetI ASST 1 cut(s) 125
SfaNI GCATC 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 4 cut(s) 68, 92, 207, 283
SspMI CTAG 1 cut(s) 59
TaaI ACNGT 1 cut(s) 232
TaiI ACGT 1 cut(s) 125
TaqI TCGA 3 cut(s) 73, 263, 287
TaqII GACCGA 1 cut(s) 281
TasI AATT 4 cut(s) 68, 92, 207, 283
Tth111I GACNNNGTC 1 cut(s) 32
XapI RAATTY 3 cut(s) 68, 92, 283
XmiI GTMKAC 1 cut(s) 263
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.