RchiOBHm_Chr2g0124411

Auxin-induced protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
37708827 .. 37709666
840 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGGGTTTTCGATTACCTGGAATTGCTAGCACAAAGACATCAGATATCCCAAAAGGCTACTTTGCAGTCTTGTTGGAGAGGAAAGATCCCACATTGGAAAACCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAAGCTGAAGAAGAATTTGGATACCATCATCCAATGGGCGGTATCACAATTCCTTGCAGTGAAGACACCTTCATTGATCTCACTTCCCGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.6

Weight (kDa)

9.92

Isoelectric Point (pI)

18.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 10 - 59 4.4e-09 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024882)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 203, 252
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 178
AcuI CTGAAG 2 cut(s) 185, 191
AfiI CCNNNNNNNGG 1 cut(s) 202
AgsI TTSAA 1 cut(s) 139
AjnI CCWGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 4 cut(s) 135, 164, 167, 196
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AlwI GGATC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 178
AsuNHI GCTAGC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 233
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 1 cut(s) 178
BfaI CTAG 1 cut(s) 27
BfuI GTATCC 1 cut(s) 178
Bme1390I CCNGG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 18
BmtI GCTAGC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 233
Bsc4I CCNNNNNNNGG 1 cut(s) 202
BseBI CCWGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 202
BslI CCNNNNNNNGG 1 cut(s) 202
Bsp143I GATC 2 cut(s) 85, 240
BspACI CCGC 2 cut(s) 203, 252
BspLI GGNNCC 1 cut(s) 123
BspOI GCTAGC 1 cut(s) 30
BspPI GGATC 1 cut(s) 80
BssMI GATC 2 cut(s) 85, 240
Bst2UI CCWGG 1 cut(s) 18
BstC8I GCNNGC 1 cut(s) 28
BstF5I GGATG 1 cut(s) 192
BstKTI GATC 2 cut(s) 88, 243
BstMBI GATC 2 cut(s) 85, 240
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 233
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BsuI GTATCC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 192
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 1 cut(s) 228
Cac8I GCNNGC 1 cut(s) 28
CviJI RGCY 2 cut(s) 57, 169
CviKI_1 RGCY 2 cut(s) 57, 169
DpnI GATC 2 cut(s) 87, 242
DpnII GATC 2 cut(s) 85, 240
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 2 cut(s) 185, 191
EcoRII CCWGG 1 cut(s) 16
EcoRV GATATC 1 cut(s) 46
FaiI YATR 1 cut(s) 133
FokI GGATG 1 cut(s) 179
FspBI CTAG 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 243
HpyCH4V TGCA 2 cut(s) 65, 221
Kzo9I GATC 2 cut(s) 85, 240
LpnPI CCDG 4 cut(s) 3, 30, 116, 140
MaeI CTAG 1 cut(s) 27
MalI GATC 2 cut(s) 87, 242
MboI GATC 2 cut(s) 85, 240
MboII GAAGA 4 cut(s) 118, 184, 187, 238
MflI RGATCY 1 cut(s) 85
MluCI AATT 3 cut(s) 21, 178, 212
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 1 cut(s) 72
MseI TTAA 1 cut(s) 256
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NdeII GATC 2 cut(s) 85, 240
NheI GCTAGC 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 123
PsuI RGATCY 1 cut(s) 85
SaqAI TTAA 1 cut(s) 256
Sau3AI GATC 2 cut(s) 85, 240
ScrFI CCNGG 1 cut(s) 18
SetI ASST 4 cut(s) 19, 148, 171, 235
SgeI CNNG 7 cut(s) 29, 30, 39, 82, 115, 167, 230
Sse9I AATT 3 cut(s) 21, 178, 212
SsiI CCGC 2 cut(s) 203, 252
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 16
TaqI TCGA 1 cut(s) 10
TasI AATT 3 cut(s) 21, 178, 212
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TscAI CASTG 1 cut(s) 228
TspDTI ATGAA 1 cut(s) 225
TspRI CASTG 1 cut(s) 228
XapI RAATTY 1 cut(s) 178
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.