RchiOBHm_Chr7g0210841

Auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0024882
Physical Location & Seq
Reverse (-)
28203740 .. 28204177
438 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18865

Sequence Viewer

Length: 438 bp
ATGATTTTCCGTATACCCTTTCATCTATATATACACACATACATGATTAGGTTCCTCAACAACTCAACTCTTTTCCTTGCAAGCATCGAAGCTTTCTCTGTTACCAACTCCTTATTCTTATCTCCTGCTTCAAGCCTTCAATCACATAAAAATATAGAAACGATGGGTTTCCGATTGCCTGGAATCTCTAACACAAAGAGAAGTCTTACTCCATACCAAACCGTTTCAAAGACATCAGATATCCCAAAAGGCTACTTTGCAGTCTATGTTGGGGAGAGCCAAAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAGTAAGCTGAAGAAGAATTCGGATACCATCATCCAATGGGTGGTATCACAATTCCTTGCAGTGAGGACACCTTCCTTGATCTCACTTCCCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

145

Amino Acids

16.52

Weight (kDa)

10.05

Isoelectric Point (pI)

45.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 71 - 119 1.3e-13 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024882)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0124411 RchiOBHm_Chr5g0059901 RchiOBHm_Chr7g0210841

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 382
AccI GTMKAC 1 cut(s) 13
AcsI RAATTY 1 cut(s) 358
AcuI CTGAAG 1 cut(s) 371
AfiI CCNNNNNNNGG 1 cut(s) 382
AgsI TTSAA 4 cut(s) 132, 140, 228, 316
AjnI CCWGG 1 cut(s) 178
AjuI GAANNNNNNNTTGG 4 cut(s) 98, 130, 312, 344
AluBI AGCT 2 cut(s) 92, 349
AluI AGCT 2 cut(s) 92, 349
ApoI RAATTY 1 cut(s) 358
BccI CCATC 2 cut(s) 157, 377
BciT130I CCWGG 1 cut(s) 180
BciVI GTATCC 1 cut(s) 358
BfuI GTATCC 1 cut(s) 358
Bme1390I CCNGG 1 cut(s) 180
BmiI GGNNCC 2 cut(s) 53, 300
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 1 cut(s) 93
Bsc4I CCNNNNNNNGG 1 cut(s) 382
BseBI CCWGG 1 cut(s) 180
BseGI GGATG 1 cut(s) 372
BseLI CCNNNNNNNGG 1 cut(s) 382
BseMII CTCAG 1 cut(s) 332
BslI CCNNNNNNNGG 1 cut(s) 382
Bsp143I GATC 1 cut(s) 420
BspCNI CTCAG 1 cut(s) 333
BspLI GGNNCC 2 cut(s) 53, 300
BssMI GATC 1 cut(s) 420
BssNAI GTATAC 1 cut(s) 14
Bst1107I GTATAC 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 223
BstC8I GCNNGC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 341
BstF5I GGATG 1 cut(s) 372
BstKTI GATC 1 cut(s) 423
BstMBI GATC 1 cut(s) 420
BstMWI GCNNNNNNNGC 1 cut(s) 346
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstZ17I GTATAC 1 cut(s) 14
BsuI GTATCC 1 cut(s) 358
BtsCI GGATG 1 cut(s) 372
BtsI GCAGTG 1 cut(s) 408
BtsIMutI CAGTG 1 cut(s) 408
Cac8I GCNNGC 1 cut(s) 82
CviAII CATG 1 cut(s) 43
CviJI RGCY 5 cut(s) 92, 135, 252, 279, 349
CviKI_1 RGCY 5 cut(s) 92, 135, 252, 279, 349
DdeI CTNAG 1 cut(s) 341
DpnI GATC 1 cut(s) 422
DpnII GATC 1 cut(s) 420
Eco32I GATATC 1 cut(s) 241
Eco57I CTGAAG 1 cut(s) 371
EcoRI GAATTC 1 cut(s) 358
EcoRII CCWGG 1 cut(s) 178
EcoRV GATATC 1 cut(s) 241
FaeI CATG 1 cut(s) 46
FatI CATG 1 cut(s) 42
FblI GTMKAC 1 cut(s) 13
FokI GGATG 1 cut(s) 359
Hin1II CATG 1 cut(s) 46
HindIII AAGCTT 1 cut(s) 90
HinfI GANTC 1 cut(s) 183
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 3 cut(s) 173, 238, 364
Hpy188III TCNNGA 1 cut(s) 332
Hpy8I GTNNAC 1 cut(s) 14
HpyAV CCTTC 2 cut(s) 146, 423
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4V TGCA 3 cut(s) 80, 260, 401
HpyF10VI GCNNNNNNNGC 1 cut(s) 346
HpyF3I CTNAG 1 cut(s) 341
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 420
LpnPI CCDG 4 cut(s) 138, 165, 192, 317
LweI GCATC 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 422
MboI GATC 1 cut(s) 420
MboII GAAGA 2 cut(s) 364, 367
MluCI AATT 2 cut(s) 358, 392
MnlI CCTC 2 cut(s) 65, 399
MslI CAYNNNNRTG 1 cut(s) 41
MspR9I CCNGG 1 cut(s) 180
MvaI CCWGG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 346
NdeII GATC 1 cut(s) 420
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 2 cut(s) 53, 300
PfeI GAWTC 1 cut(s) 183
PflMI CCANNNNNTGG 1 cut(s) 382
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 53, 300
RseI CAYNNNNRTG 1 cut(s) 41
Sau3AI GATC 1 cut(s) 420
ScrFI CCNGG 1 cut(s) 180
SetI ASST 6 cut(s) 53, 94, 325, 351, 415, 437
SfaNI GCATC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 41
Sse9I AATT 2 cut(s) 358, 392
StyD4I CCNGG 1 cut(s) 178
TaaI ACNGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 87
TasI AATT 2 cut(s) 358, 392
TfiI GAWTC 1 cut(s) 183
TscAI CASTG 1 cut(s) 408
TspDTI ATGAA 1 cut(s) 11
TspRI CASTG 1 cut(s) 408
Van91I CCANNNNNTGG 1 cut(s) 382
XapI RAATTY 1 cut(s) 358
XmiI GTMKAC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.