RchiOBHm_Chr2g0133671

Fatty acid amide

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
50541851 .. 50542332
482 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGACTCAGTTATTGAGGAACACTGTGATTCCAGAAGCACCCATGTTCAAACCTAAATTTCCTCCTCAAGAACCAGAAACCGGGGTTGTTGTTGTGGATGAGGATGGAAAACCAGAAGACAGAGTTGGAGTGGCCTTGAAATGTCTTCCAAACTATGATCCTGCTACCTGTTTGTTCGAAACAGTTTAA

Protein Analysis

62

Amino Acids

6.87

Weight (kDa)

4.49

Isoelectric Point (pI)

45.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024891)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0133671
rosa_multiflora Rmu_sc0000259.1_g000039
rosa_samantha Rh2BG492800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AcsI RAATTY 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 80
AgsI TTSAA 2 cut(s) 49, 139
AjuI GAANNNNNNNTTGG 2 cut(s) 108, 140
AlwI GGATC 1 cut(s) 152
AoxI GGCC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 56
AsuC2I CCSGG 1 cut(s) 82
AsuII TTCGAA 1 cut(s) 177
BbsI GAAGAC 2 cut(s) 123, 137
BccI CCATC 1 cut(s) 98
BcnI CCSGG 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 82
BmrFI CCNGG 1 cut(s) 82
BpiI GAAGAC 2 cut(s) 123, 137
Bpu14I TTCGAA 1 cut(s) 177
BpuEI CTTGAG 1 cut(s) 51
BpuMI CCSGG 1 cut(s) 82
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 2 cut(s) 103, 109
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 54
BshFI GGCC 1 cut(s) 134
BsiSI CCGG 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 80
BsnI GGCC 1 cut(s) 134
Bsp119I TTCGAA 1 cut(s) 177
Bsp143I GATC 1 cut(s) 157
BspANI GGCC 1 cut(s) 134
BspCNI CTCAG 1 cut(s) 19
BspPI GGATC 1 cut(s) 152
BspT104I TTCGAA 1 cut(s) 177
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 157
Bst4CI ACNGT 2 cut(s) 25, 184
BstBI TTCGAA 1 cut(s) 177
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 103, 109
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 80
BstV2I GAAGAC 2 cut(s) 123, 137
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 2 cut(s) 103, 109
BtsIMutI CAGTG 1 cut(s) 21
CviAII CATG 1 cut(s) 43
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
FaeI CATG 1 cut(s) 46
FaiI YATR 2 cut(s) 44, 156
FatI CATG 1 cut(s) 42
FokI GGATG 2 cut(s) 110, 116
HaeIII GGCC 1 cut(s) 134
HapII CCGG 1 cut(s) 81
Hin1II CATG 1 cut(s) 46
HinfI GANTC 2 cut(s) 4, 28
HpaII CCGG 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 32, 68
HpyCH4III ACNGT 2 cut(s) 25, 184
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 6 cut(s) 45, 87, 94, 126, 174, 181
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 2 cut(s) 128, 137
MluCI AATT 1 cut(s) 56
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 4 cut(s) 9, 72, 75, 94
MseI TTAA 1 cut(s) 187
MspI CCGG 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 82
NciI CCSGG 1 cut(s) 82
NdeII GATC 1 cut(s) 157
NlaIII CATG 1 cut(s) 46
NspV TTCGAA 1 cut(s) 177
PfeI GAWTC 1 cut(s) 28
SaqAI TTAA 1 cut(s) 187
Sau3AI GATC 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 82
SetI ASST 2 cut(s) 55, 170
SfuI TTCGAA 1 cut(s) 177
SmlI CTYRAG 1 cut(s) 66
SmoI CTYRAG 1 cut(s) 66
Sse9I AATT 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 2 cut(s) 25, 184
TaqI TCGA 1 cut(s) 177
TasI AATT 1 cut(s) 56
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 187
Tru9I TTAA 1 cut(s) 187
TscAI CASTG 1 cut(s) 28
TspRI CASTG 1 cut(s) 28
XapI RAATTY 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.