Rh2BG492800

Fatty acid amide

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
69206154 .. 69206736
583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG492800.1

Sequence Viewer

Length: 234 bp
ATGGATGTAGGTTTCAAGTTCGAAGACATGCAAGCTTTTGAAGTCAATCTCAAGTTATTGAGGAACACTGTGATTCCAGAAGCACCCATGTTCAAACCTGAATTTCCTCCTCAAGAACCAGAAACCGGGGTTGTTGTTGTGGATGAGGATGGAAAACCAGAAGACAGAGTTGGAGTGGCCTTGAAATGTCTTCCAAACTATGATCCTGCTACCTGTTTGTTCGAAACAGTTTAA

Protein Analysis

77

Amino Acids

8.64

Weight (kDa)

4.25

Isoelectric Point (pI)

38.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024891)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0133671
rosa_multiflora Rmu_sc0000259.1_g000039
rosa_samantha Rh2BG492800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 197
AcsI RAATTY 1 cut(s) 101
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 4 cut(s) 16, 41, 94, 184
AjuI GAANNNNNNNTTGG 2 cut(s) 153, 185
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AlwI GGATC 1 cut(s) 197
AoxI GGCC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 101
AsuC2I CCSGG 1 cut(s) 127
AsuII TTCGAA 2 cut(s) 21, 222
BbsI GAAGAC 3 cut(s) 30, 168, 182
BccI CCATC 1 cut(s) 143
BcnI CCSGG 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 127
BpiI GAAGAC 3 cut(s) 30, 168, 182
Bpu14I TTCGAA 2 cut(s) 21, 222
BpuEI CTTGAG 2 cut(s) 35, 96
BpuMI CCSGG 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 126
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 3 cut(s) 10, 148, 154
BseLI CCNNNNNNNGG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 99
BshFI GGCC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 125
BsnI GGCC 1 cut(s) 179
Bsp119I TTCGAA 2 cut(s) 21, 222
Bsp143I GATC 1 cut(s) 202
BspANI GGCC 1 cut(s) 179
BspPI GGATC 1 cut(s) 197
BspT104I TTCGAA 2 cut(s) 21, 222
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 2 cut(s) 70, 229
BstBI TTCGAA 2 cut(s) 21, 222
BstC8I GCNNGC 1 cut(s) 33
BstF5I GGATG 3 cut(s) 10, 148, 154
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BstNSI RCATGY 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 125
BstV2I GAAGAC 3 cut(s) 30, 168, 182
BsuRI GGCC 1 cut(s) 179
BtsCI GGATG 3 cut(s) 10, 148, 154
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 33
CviAII CATG 2 cut(s) 28, 88
CviJI RGCY 2 cut(s) 35, 179
CviKI_1 RGCY 2 cut(s) 35, 179
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
FaeI CATG 2 cut(s) 31, 91
FaiI YATR 3 cut(s) 29, 89, 201
FatI CATG 2 cut(s) 27, 87
FokI GGATG 3 cut(s) 17, 155, 161
HaeIII GGCC 1 cut(s) 179
HapII CCGG 1 cut(s) 126
Hin1II CATG 2 cut(s) 31, 91
HindIII AAGCTT 1 cut(s) 33
HinfI GANTC 1 cut(s) 73
HpaII CCGG 1 cut(s) 126
Hpy188III TCNNGA 2 cut(s) 77, 113
HpyCH4III ACNGT 2 cut(s) 70, 229
HpyCH4V TGCA 1 cut(s) 31
Hsp92II CATG 2 cut(s) 31, 91
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 7 cut(s) 90, 111, 132, 139, 171, 219, 226
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 3 cut(s) 35, 173, 182
MluCI AATT 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 4 cut(s) 54, 117, 120, 139
MseI TTAA 1 cut(s) 232
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 127
NciI CCSGG 1 cut(s) 127
NdeII GATC 1 cut(s) 202
NlaIII CATG 2 cut(s) 31, 91
NspI RCATGY 1 cut(s) 31
NspV TTCGAA 2 cut(s) 21, 222
PfeI GAWTC 1 cut(s) 73
SaqAI TTAA 1 cut(s) 232
Sau3AI GATC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 127
SetI ASST 4 cut(s) 13, 37, 100, 215
SfuI TTCGAA 2 cut(s) 21, 222
SmlI CTYRAG 2 cut(s) 50, 111
SmoI CTYRAG 2 cut(s) 50, 111
Sse9I AATT 1 cut(s) 101
StyD4I CCNGG 1 cut(s) 125
TaaI ACNGT 2 cut(s) 70, 229
TaqI TCGA 2 cut(s) 21, 222
TasI AATT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 1 cut(s) 232
Tru9I TTAA 1 cut(s) 232
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
XapI RAATTY 1 cut(s) 101
XceI RCATGY 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.