RchiOBHm_Chr2g0141231

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
58796626 .. 58796864
239 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGAAATTAAGTTCCTTTCACAAGCTTTCATTTCTGTCCATTTATTGCCTCACCTGATAGTTGTTGCAATCACAAACATCAAGGAAACTTATAAAATTAGAAAAAACTGGCAAGGAGATCCATGTTCCCCTCAAGCTTACTCATGGGAGGGCATAAACTGTGTAGCTATCATGCTTATGAGCCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

62

Amino Acids

7.08

Weight (kDa)

7.82

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017471)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AclWI GGATC 1 cut(s) 113
AloI GAACNNNNNNTCC 1 cut(s) 28
AluBI AGCT 3 cut(s) 26, 137, 167
AluI AGCT 3 cut(s) 26, 137, 167
AlwI GGATC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 44
BanII GRGCYC 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 117
Bse1I ACTGG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 113
Bsp1286I GDGCHC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 118
BspPI GGATC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 113
BssMI GATC 1 cut(s) 118
Bst4CI ACNGT 1 cut(s) 161
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 118
BstYI RGATCY 1 cut(s) 118
CviAII CATG 3 cut(s) 123, 144, 172
CviJI RGCY 4 cut(s) 26, 137, 167, 183
CviKI_1 RGCY 4 cut(s) 26, 137, 167, 183
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
Eco24I GRGCYC 1 cut(s) 185
EcoT38I GRGCYC 1 cut(s) 185
FaeI CATG 3 cut(s) 126, 147, 175
FaiI YATR 6 cut(s) 93, 124, 145, 155, 173, 179
FatI CATG 3 cut(s) 122, 143, 171
FriOI GRGCYC 1 cut(s) 185
Hin1II CATG 3 cut(s) 126, 147, 175
HindIII AAGCTT 2 cut(s) 24, 135
HphI GGTGA 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 68
Hsp92II CATG 3 cut(s) 126, 147, 175
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 68, 94
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MflI RGATCY 1 cut(s) 118
MhlI GDGCHC 1 cut(s) 185
MluCI AATT 2 cut(s) 6, 96
MnlI CCTC 3 cut(s) 60, 141, 142
MseI TTAA 1 cut(s) 9
MslI CAYNNNNRTG 1 cut(s) 176
NdeII GATC 1 cut(s) 118
NlaIII CATG 3 cut(s) 126, 147, 175
PsiI TTATAA 1 cut(s) 93
PsuI RGATCY 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 176
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 1 cut(s) 118
SduI GDGCHC 1 cut(s) 185
SetI ASST 4 cut(s) 28, 57, 139, 169
SgeI CNNG 9 cut(s) 35, 67, 94, 121, 125, 135, 146, 156, 184
SmiMI CAYNNNNRTG 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 132
SmoI CTYRAG 1 cut(s) 132
Sse9I AATT 2 cut(s) 6, 96
TaaI ACNGT 1 cut(s) 161
TasI AATT 2 cut(s) 6, 96
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.