RchiOBHm_Chr2g0146991

Belongs to the complex I LYR family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
64663272 .. 64663999
728 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGCTCAAGGGCTCTGCGGTAGAGGTTCGCCAAAAATTTGAGGAGAATAGGGGTGTGACATCAGAGGAGGAGGTCCAGAGACTGCTTGGCGAGGCATACGAGGCCTCCAGCTTCATCTCCACCATGATCGTCCAGGCCAAGCTCAATTCCGGCGGAGGCTACATTTTTCATTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.41

Weight (kDa)

5.23

Isoelectric Point (pI)

28.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Complex1_LYR PF05347 7 - 35 6.4e-06 Complex 1 protein (LYR family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024875)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0146991
rosa_multiflora Rmu_co8299793.1_g000001
rosa_samantha Rh2CG442200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 17, 153
AcsI RAATTY 1 cut(s) 35
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 2 cut(s) 111, 142
AluI AGCT 2 cut(s) 111, 142
Alw26I GTCTC 1 cut(s) 73
AlwNI CAGNNNCTG 1 cut(s) 82
AoxI GGCC 2 cut(s) 102, 135
ApoI RAATTY 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 73
AvaII GGWCC 1 cut(s) 73
BanII GRGCYC 1 cut(s) 14
BciT130I CCWGG 1 cut(s) 134
BcoDI GTCTC 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 134
Bme18I GGWCC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 91
BsaXI ACNNNNNCTCC 2 cut(s) 89, 119
BseBI CCWGG 1 cut(s) 134
BseRI GAGGAG 3 cut(s) 56, 80, 83
BshFI GGCC 2 cut(s) 104, 137
BsiSI CCGG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 2 cut(s) 104, 137
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 126
BspACI CCGC 2 cut(s) 17, 153
BspANI GGCC 2 cut(s) 104, 137
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 134
BstKTI GATC 1 cut(s) 129
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BsuRI GGCC 2 cut(s) 104, 137
CaiI CAGNNNCTG 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 73
CviAII CATG 1 cut(s) 124
CviJI RGCY 6 cut(s) 12, 104, 111, 137, 142, 159
CviKI_1 RGCY 6 cut(s) 12, 104, 111, 137, 142, 159
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
EciI GGCGGA 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 104
Eco24I GRGCYC 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 132
EcoT38I GRGCYC 1 cut(s) 14
FaeI CATG 1 cut(s) 127
FaiI YATR 2 cut(s) 97, 125
FatI CATG 1 cut(s) 123
FriOI GRGCYC 1 cut(s) 14
GsuI CTGGAG 1 cut(s) 91
HaeIII GGCC 2 cut(s) 104, 137
HapII CCGG 1 cut(s) 150
Hin1II CATG 1 cut(s) 127
HpaII CCGG 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
Hsp92II CATG 1 cut(s) 127
Kzo9I GATC 1 cut(s) 126
LpnPI CCDG 5 cut(s) 89, 119, 121, 146, 163
MaeIII GTNAC 1 cut(s) 55
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MhlI GDGCHC 1 cut(s) 14
MluCI AATT 2 cut(s) 35, 145
MnlI CCTC 9 cut(s) 16, 34, 58, 61, 64, 85, 94, 115, 149
MspI CCGG 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 1 cut(s) 126
NlaIII CATG 1 cut(s) 127
NmuCI GTSAC 1 cut(s) 55
PceI AGGCCT 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 73
PstNI CAGNNNCTG 1 cut(s) 82
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 134
SduI GDGCHC 1 cut(s) 14
SetI ASST 4 cut(s) 27, 75, 113, 144
SinI GGWCC 1 cut(s) 73
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 2 cut(s) 35, 145
SseBI AGGCCT 1 cut(s) 104
SsiI CCGC 2 cut(s) 17, 153
StuI AGGCCT 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 132
TasI AATT 2 cut(s) 35, 145
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 2 cut(s) 103, 158
VpaK11BI GGWCC 1 cut(s) 73
XapI RAATTY 1 cut(s) 35
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.