Rmu_co8299793.1_g000001

Belongs to the complex I LYR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8299793.1
OG0024875
Physical Location & Seq
Forward (+)
1 .. 485
485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8299793.1_g000001.1.cds

Sequence Viewer

Length: 196 bp
tttcgccggagacaccgtgatgctcaagggctctgcggtagaggttcgccaaaaatttgaggagaataggggtgtgacatcagaggaggagatccagagactgcttggcgaggcatacgaggcctccagcttcatctccaccatgatcgtccaggccaagcttaattccggcggaggctacatttttcattcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Complex1_LYR

Protein Analysis

64

Amino Acids

7.01

Weight (kDa)

4.95

Isoelectric Point (pI)

27.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024875)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0146991
rosa_multiflora Rmu_co8299793.1_g000001
rosa_samantha Rh2CG442200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 36, 172
AclWI GGATC 1 cut(s) 86
AcsI RAATTY 1 cut(s) 54
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 2 cut(s) 130, 161
AluI AGCT 2 cut(s) 130, 161
Alw26I GTCTC 2 cut(s) 4, 92
AlwI GGATC 1 cut(s) 86
AlwNI CAGNNNCTG 1 cut(s) 101
AoxI GGCC 2 cut(s) 121, 154
ApoI RAATTY 1 cut(s) 54
BanII GRGCYC 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 153
BcoDI GTCTC 2 cut(s) 4, 92
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BmsI GCATC 1 cut(s) 10
BpmI CTGGAG 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 9
BsaXI ACNNNNNCTCC 3 cut(s) 31, 108, 138
BseBI CCWGG 1 cut(s) 153
BseRI GAGGAG 3 cut(s) 75, 99, 102
BshFI GGCC 2 cut(s) 123, 156
BsiSI CCGG 2 cut(s) 7, 169
BsmAI GTCTC 2 cut(s) 4, 92
BsnI GGCC 2 cut(s) 123, 156
Bsp1286I GDGCHC 1 cut(s) 33
Bsp143I GATC 2 cut(s) 91, 145
BspACI CCGC 2 cut(s) 36, 172
BspANI GGCC 2 cut(s) 123, 156
BspPI GGATC 1 cut(s) 86
BssMI GATC 2 cut(s) 91, 145
Bst2UI CCWGG 1 cut(s) 153
Bst4CI ACNGT 1 cut(s) 17
BstKTI GATC 2 cut(s) 94, 148
BstMAI GTCTC 2 cut(s) 4, 92
BstMBI GATC 2 cut(s) 91, 145
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BsuRI GGCC 2 cut(s) 123, 156
CaiI CAGNNNCTG 1 cut(s) 101
CviAII CATG 1 cut(s) 143
CviJI RGCY 6 cut(s) 31, 123, 130, 156, 161, 178
CviKI_1 RGCY 6 cut(s) 31, 123, 130, 156, 161, 178
DpnI GATC 2 cut(s) 93, 147
DpnII GATC 2 cut(s) 91, 145
EciI GGCGGA 1 cut(s) 187
Eco147I AGGCCT 1 cut(s) 123
Eco24I GRGCYC 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 151
EcoT38I GRGCYC 1 cut(s) 33
FaeI CATG 1 cut(s) 146
FaiI YATR 2 cut(s) 116, 144
FatI CATG 1 cut(s) 142
FriOI GRGCYC 1 cut(s) 33
GsuI CTGGAG 1 cut(s) 110
HaeIII GGCC 2 cut(s) 123, 156
HapII CCGG 2 cut(s) 7, 169
Hin1II CATG 1 cut(s) 146
HindIII AAGCTT 1 cut(s) 159
HpaII CCGG 2 cut(s) 7, 169
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 95
HpyCH4III ACNGT 1 cut(s) 17
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 2 cut(s) 91, 145
LpnPI CCDG 6 cut(s) 20, 108, 138, 140, 165, 182
LweI GCATC 1 cut(s) 10
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 93, 147
MboI GATC 2 cut(s) 91, 145
MflI RGATCY 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 33
MluCI AATT 2 cut(s) 54, 164
MnlI CCTC 8 cut(s) 35, 53, 77, 80, 104, 113, 134, 168
MseI TTAA 1 cut(s) 163
MslI CAYNNNNRTG 1 cut(s) 18
MspI CCGG 2 cut(s) 7, 169
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
MwoI GCNNNNNNNGC 1 cut(s) 120
NdeII GATC 2 cut(s) 91, 145
NlaIII CATG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 74
PceI AGGCCT 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 101
PsuI RGATCY 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 18
SaqAI TTAA 1 cut(s) 163
Sau3AI GATC 2 cut(s) 91, 145
ScrFI CCNGG 1 cut(s) 153
SduI GDGCHC 1 cut(s) 33
SetI ASST 3 cut(s) 46, 132, 163
SfaNI GCATC 1 cut(s) 10
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
Sse9I AATT 2 cut(s) 54, 164
SseBI AGGCCT 1 cut(s) 123
SsiI CCGC 2 cut(s) 36, 172
StuI AGGCCT 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 151
TaaI ACNGT 1 cut(s) 17
TasI AATT 2 cut(s) 54, 164
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 122, 177
XapI RAATTY 1 cut(s) 54
XcmI CCANNNNNNNNNTGG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.