RchiOBHm_Chr2g0160941

Eukaryotic protein of unknown function (DUF829)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
76833111 .. 76835374
2264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGGGTCTAGCTTTTGCCAGATGGACAGCTAACGAGCTAAGGATGAAGCCGTGTTATGTAGTTTTTGTGGGTCTCTCAGCTGGTATTAAAGCTTGTATGTACAAAGTTTTTCAACTGATTCTGTTTCCTGCTATCCTGACTGCTAGTTTTCAAGCAGTTTCTGTTTCTGTTTCAAGCTATGTATTCCCCTCTCTCAAATTCTCATTATCTCAATTGCATCTCTTTTCTCATAATCTCAATTGCATCTCTTTAAAGGAGACCATTCATTGTATGATCTTTGATTACAAGAAAGAAAAAAAAGGAAAAACAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.73

Weight (kDa)

9.58

Isoelectric Point (pI)

39.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019366)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 197
AfaI GTAC 1 cut(s) 101
AgsI TTSAA 3 cut(s) 113, 152, 174
AluBI AGCT 6 cut(s) 11, 29, 37, 80, 92, 177
AluI AGCT 6 cut(s) 11, 29, 37, 80, 92, 177
Alw26I GTCTC 2 cut(s) 77, 251
AlwNI CAGNNNCTG 1 cut(s) 161
ApoI RAATTY 1 cut(s) 197
BccI CCATC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 34
BcoDI GTCTC 2 cut(s) 77, 251
BfaI CTAG 2 cut(s) 8, 144
BmsI GCATC 2 cut(s) 226, 252
Bpu10I CCTNAGC 1 cut(s) 38
BsaI GGTCTC 2 cut(s) 77, 251
BseGI GGATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 90
BsmAI GTCTC 2 cut(s) 77, 251
Bso31I GGTCTC 2 cut(s) 77, 251
Bsp1407I TGTACA 1 cut(s) 99
Bsp143I GATC 1 cut(s) 273
BspCNI CTCAG 1 cut(s) 89
BspTNI GGTCTC 2 cut(s) 77, 251
BsrGI TGTACA 1 cut(s) 99
BssMI GATC 1 cut(s) 273
BstAUI TGTACA 1 cut(s) 99
BstDEI CTNAG 2 cut(s) 38, 76
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 1 cut(s) 276
BstMAI GTCTC 2 cut(s) 77, 251
BstMBI GATC 1 cut(s) 273
BtsCI GGATG 1 cut(s) 48
CaiI CAGNNNCTG 1 cut(s) 161
Csp6I GTAC 1 cut(s) 100
CviJI RGCY 7 cut(s) 11, 29, 37, 49, 80, 92, 177
CviKI_1 RGCY 7 cut(s) 11, 29, 37, 49, 80, 92, 177
CviQI GTAC 1 cut(s) 100
DdeI CTNAG 2 cut(s) 38, 76
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
DraI TTTAAA 1 cut(s) 252
Eco31I GGTCTC 2 cut(s) 77, 251
FaiI YATR 6 cut(s) 57, 98, 180, 231, 272, 313
FokI GGATG 1 cut(s) 55
FspBI CTAG 2 cut(s) 8, 144
HindIII AAGCTT 1 cut(s) 90
HinfI GANTC 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 136
HpyCH4V TGCA 2 cut(s) 217, 243
HpyF3I CTNAG 2 cut(s) 38, 76
Kzo9I GATC 1 cut(s) 273
LpnPI CCDG 4 cut(s) 31, 66, 141, 149
LweI GCATC 2 cut(s) 226, 252
MaeI CTAG 2 cut(s) 8, 144
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MfeI CAATTG 2 cut(s) 212, 238
MluCI AATT 3 cut(s) 197, 212, 238
MnlI CCTC 1 cut(s) 199
MseI TTAA 2 cut(s) 87, 251
MspA1I CMGCKG 1 cut(s) 80
MunI CAATTG 2 cut(s) 212, 238
NdeII GATC 1 cut(s) 273
PfeI GAWTC 1 cut(s) 118
PstNI CAGNNNCTG 1 cut(s) 161
PvuII CAGCTG 1 cut(s) 80
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
SaqAI TTAA 2 cut(s) 87, 251
Sau3AI GATC 1 cut(s) 273
SetI ASST 6 cut(s) 13, 31, 39, 82, 94, 179
SfaNI GCATC 2 cut(s) 226, 252
Sse9I AATT 3 cut(s) 197, 212, 238
SspMI CTAG 2 cut(s) 8, 144
TasI AATT 3 cut(s) 197, 212, 238
TatI WGTACW 1 cut(s) 99
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 2 cut(s) 87, 251
Tru9I TTAA 2 cut(s) 87, 251
TspDTI ATGAA 2 cut(s) 59, 254
XapI RAATTY 1 cut(s) 197
XspI CTAG 2 cut(s) 8, 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.