RchiOBHm_Chr1g0352911

Polyadenylate-binding protein-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
46256110 .. 46263620
7511 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 147 bp
ATGAACATGAGATGTGTGCAAGAAAATATATACTTTACAAATATTGACAAGAAGGTTTTTCAAGCTGATGTTAAGCTCTTTTTTGAATCAATTTGTGGAGAGGTTTATCATCTGAGGCTGCTCGGAGACTGTCACCTCTTTAATTGA

Protein Analysis

48

Amino Acids

5.74

Weight (kDa)

6.0

Isoelectric Point (pI)

32.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 62, 86
AluBI AGCT 2 cut(s) 65, 76
AluI AGCT 2 cut(s) 65, 76
Alw26I GTCTC 1 cut(s) 120
ApeKI GCWGC 1 cut(s) 118
AsuHPI GGTGA 1 cut(s) 125
BbvI GCAGC 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 120
BisI GCNGC 1 cut(s) 119
BlsI GCNGC 1 cut(s) 120
BseMII CTCAG 1 cut(s) 104
BseXI GCAGC 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 113
BstMAI GTCTC 1 cut(s) 120
BstV1I GCAGC 1 cut(s) 105
CviAII CATG 1 cut(s) 7
CviJI RGCY 3 cut(s) 65, 76, 118
CviKI_1 RGCY 3 cut(s) 65, 76, 118
DdeI CTNAG 1 cut(s) 113
FaeI CATG 1 cut(s) 10
FaiI YATR 3 cut(s) 8, 29, 31
FatI CATG 1 cut(s) 6
Fnu4HI GCNGC 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 119
FspEI CC 5 cut(s) 38, 81, 86, 100, 108
GluI GCNGC 1 cut(s) 119
Hin1II CATG 1 cut(s) 10
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 125
Hpy188I TCNGA 2 cut(s) 114, 125
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 10
Lsp1109I GCAGC 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 131
MluCI AATT 2 cut(s) 90, 142
MnlI CCTC 3 cut(s) 94, 108, 146
MseI TTAA 2 cut(s) 72, 141
NlaIII CATG 1 cut(s) 10
NmuCI GTSAC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 86
PkrI GCNGC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 72, 141
SatI GCNGC 1 cut(s) 119
SetI ASST 5 cut(s) 57, 67, 78, 105, 138
SgeI CNNG 5 cut(s) 19, 32, 61, 74, 134
Sse9I AATT 2 cut(s) 90, 142
SspI AATATT 1 cut(s) 43
TaaI ACNGT 1 cut(s) 131
TasI AATT 2 cut(s) 90, 142
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 72, 141
Tru9I TTAA 2 cut(s) 72, 141
TseFI GTSAC 1 cut(s) 131
TseI GCWGC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.