Rh4CG230600

Polyadenylate-binding protein-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
46915016 .. 46927779
12764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG230600.1

Sequence Viewer

Length: 345 bp
ATGTTTTTGAGTTTTTGCCATAGGAGAGACGAAGAAGAGGCTAGGAGAACCGAAAATTCCGCCAAGCCCACCATAGTTACCACCACCTGCACCTCTGCTGCTGCATCTGGCACTCAGCTAGTGTTAACTACATTTTACGGCAACATTTGTCTAATATTGTGGTTTCGATTTGCTAATGGTAATGATTTAAAGGGAGGAGACACGAAGATAGATGAGGTGAGACAACTGAGGTCTATAGGTTTCTCAAGCTATATTAAGCTCTTTTTTGAATCAGTTTGTGGAGAGGTTTATCGTCTGAGGCTGCTGGGAGACTATCACCTCTTTTATCGAAAATGTCCAAGATAA

Protein Analysis

114

Amino Acids

13.13

Weight (kDa)

8.91

Isoelectric Point (pI)

48.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 95
Acc36I ACCTGC 1 cut(s) 95
AciI CCGC 1 cut(s) 60
AcsI RAATTY 1 cut(s) 55
AgsI TTSAA 1 cut(s) 269
AluBI AGCT 3 cut(s) 118, 249, 259
AluI AGCT 3 cut(s) 118, 249, 259
Alw26I GTCTC 4 cut(s) 21, 192, 214, 303
ApeKI GCWGC 3 cut(s) 98, 101, 301
ApoI RAATTY 1 cut(s) 55
AsuHPI GGTGA 2 cut(s) 229, 308
BbvI GCAGC 3 cut(s) 85, 88, 288
BceAI ACGGC 1 cut(s) 154
BcoDI GTCTC 4 cut(s) 21, 192, 214, 303
BfaI CTAG 2 cut(s) 42, 119
BfmI CTRYAG 1 cut(s) 234
BfuAI ACCTGC 1 cut(s) 95
BisI GCNGC 3 cut(s) 99, 102, 302
BlsI GCNGC 3 cut(s) 100, 103, 303
BmsI GCATC 1 cut(s) 113
BpuEI CTTGAG 1 cut(s) 229
BseMII CTCAG 3 cut(s) 128, 218, 287
BseRI GAGGAG 1 cut(s) 210
BseXI GCAGC 3 cut(s) 85, 88, 288
BseYI CCCAGC 1 cut(s) 304
BsgI GTGCAG 1 cut(s) 73
BsmAI GTCTC 4 cut(s) 21, 192, 214, 303
BsmBI CGTCTC 1 cut(s) 21
BspACI CCGC 1 cut(s) 60
BspCNI CTCAG 3 cut(s) 127, 219, 288
BspMI ACCTGC 1 cut(s) 95
Bst6I CTCTTC 1 cut(s) 30
BstDEI CTNAG 3 cut(s) 114, 227, 296
BstMAI GTCTC 4 cut(s) 21, 192, 214, 303
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 3 cut(s) 85, 88, 288
BveI ACCTGC 1 cut(s) 95
CviJI RGCY 6 cut(s) 41, 67, 118, 249, 259, 301
CviKI_1 RGCY 6 cut(s) 41, 67, 118, 249, 259, 301
DdeI CTNAG 3 cut(s) 114, 227, 296
DraI TTTAAA 1 cut(s) 189
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
EciI GGCGGA 1 cut(s) 49
Esp3I CGTCTC 1 cut(s) 21
FaiI YATR 4 cut(s) 21, 74, 236, 252
Fnu4HI GCNGC 3 cut(s) 99, 102, 302
Fsp4HI GCNGC 3 cut(s) 99, 102, 302
FspBI CTAG 2 cut(s) 42, 119
GluI GCNGC 3 cut(s) 99, 102, 302
GsaI CCCAGC 1 cut(s) 308
HincII GTYRAC 1 cut(s) 126
HindII GTYRAC 1 cut(s) 126
HinfI GANTC 1 cut(s) 269
HpaI GTTAAC 1 cut(s) 126
HphI GGTGA 2 cut(s) 229, 308
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 297
Hpy8I GTNNAC 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 90, 104
HpyF3I CTNAG 3 cut(s) 114, 227, 296
KspAI GTTAAC 1 cut(s) 126
LpnPI CCDG 3 cut(s) 93, 100, 290
Lsp1109I GCAGC 3 cut(s) 85, 88, 288
LweI GCATC 1 cut(s) 113
MaeI CTAG 2 cut(s) 42, 119
MaeIII GTNAC 1 cut(s) 76
MboII GAAGA 3 cut(s) 44, 47, 217
MluCI AATT 1 cut(s) 55
MnlI CCTC 8 cut(s) 31, 103, 188, 208, 222, 277, 291, 329
MseI TTAA 3 cut(s) 125, 188, 255
PaqCI CACCTGC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 269
PkrI GCNGC 3 cut(s) 100, 103, 303
PspFI CCCAGC 1 cut(s) 304
SaqAI TTAA 3 cut(s) 125, 188, 255
SatI GCNGC 3 cut(s) 99, 102, 302
SfaNI GCATC 1 cut(s) 113
SfcI CTRYAG 1 cut(s) 234
SgeI CNNG 8 cut(s) 54, 76, 99, 120, 131, 214, 258, 317
SmlI CTYRAG 1 cut(s) 244
SmoI CTYRAG 1 cut(s) 244
Sse9I AATT 1 cut(s) 55
SsiI CCGC 1 cut(s) 60
SspI AATATT 1 cut(s) 156
SspMI CTAG 2 cut(s) 42, 119
TaqI TCGA 2 cut(s) 166, 328
TasI AATT 1 cut(s) 55
TfiI GAWTC 1 cut(s) 269
Tru1I TTAA 3 cut(s) 125, 188, 255
Tru9I TTAA 3 cut(s) 125, 188, 255
TseI GCWGC 3 cut(s) 98, 101, 301
XapI RAATTY 1 cut(s) 55
XspI CTAG 2 cut(s) 42, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.