RchiOBHm_Chr1g0366391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
56959032 .. 56960457
1426 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59095

Sequence Viewer

Length: 225 bp
ATGGTATGCTCTTGTCTCTTATACAATATCTGCCACAACTTTGGTGAACTTTGTTTGTTTCTAAATGGATTCTTTAATTTTGTTGCAATAGAATTATCACTGGATAGGAACATGTTTAAAGGTACTTTCTGTATAATCACTGGCTTCAGAAGAGATTTATTTTACCACCAAGGGTTTCATTTAAGTAATCTATTGTTAATCCCTGTTTTTGGAGTTATTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.64

Weight (kDa)

6.79

Isoelectric Point (pI)

44.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024731)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0366391
rosa_roxburghii Rroxscaffold_4G00289950 Rroxscaffold_4G00290230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 130
AfaI GTAC 1 cut(s) 124
AfiI CCNNNNNNNGG 1 cut(s) 209
AflIII ACRYGT 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 20
AsuHPI GGTGA 1 cut(s) 56
BcoDI GTCTC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 169
Bsc4I CCNNNNNNNGG 1 cut(s) 209
Bse1I ACTGG 2 cut(s) 105, 145
BseDI CCNNGG 1 cut(s) 169
BseLI CCNNNNNNNGG 1 cut(s) 209
BseNI ACTGG 2 cut(s) 105, 145
BslI CCNNNNNNNGG 1 cut(s) 209
BsmAI GTCTC 1 cut(s) 20
BsrI ACTGG 2 cut(s) 105, 145
BssECI CCNNGG 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 169
Bst6I CTCTTC 1 cut(s) 145
BstMAI GTCTC 1 cut(s) 20
BstNSI RCATGY 1 cut(s) 115
BstXI CCANNNNNNTGG 1 cut(s) 41
BtsIMutI CAGTG 2 cut(s) 98, 138
Csp6I GTAC 1 cut(s) 123
CviAII CATG 1 cut(s) 112
CviJI RGCY 1 cut(s) 144
CviKI_1 RGCY 1 cut(s) 144
CviQI GTAC 1 cut(s) 123
DraI TTTAAA 1 cut(s) 118
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 169
Eco57I CTGAAG 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 169
ErhI CCWWGG 1 cut(s) 169
FaeI CATG 1 cut(s) 115
FaiI YATR 4 cut(s) 7, 22, 113, 134
FatI CATG 1 cut(s) 111
Hin1II CATG 1 cut(s) 115
HinfI GANTC 1 cut(s) 69
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 149
Hpy8I GTNNAC 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 86
Hsp92II CATG 1 cut(s) 115
LpnPI CCDG 3 cut(s) 86, 126, 216
MboII GAAGA 1 cut(s) 162
MluCI AATT 2 cut(s) 76, 92
MseI TTAA 4 cut(s) 75, 117, 182, 197
NlaIII CATG 1 cut(s) 115
NspI RCATGY 1 cut(s) 115
PciI ACATGT 1 cut(s) 111
PfeI GAWTC 1 cut(s) 69
PscI ACATGT 1 cut(s) 111
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SaqAI TTAA 4 cut(s) 75, 117, 182, 197
SetI ASST 1 cut(s) 124
SgeI CNNG 6 cut(s) 24, 113, 124, 153, 182, 215
Sse9I AATT 2 cut(s) 76, 92
StyI CCWWGG 1 cut(s) 169
TasI AATT 2 cut(s) 76, 92
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 4 cut(s) 75, 117, 182, 197
Tru9I TTAA 4 cut(s) 75, 117, 182, 197
TscAI CASTG 2 cut(s) 105, 145
TspDTI ATGAA 1 cut(s) 167
TspRI CASTG 2 cut(s) 105, 145
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.