RchiOBHm_Chr1g0374851

Aldo-keto reductase family 4 member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0022439
Physical Location & Seq
Forward (+)
62512433 .. 62516443
4011 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59862

Sequence Viewer

Length: 297 bp
ATGATATTTGGATTCTCAATTCCAGCCTTTCCAATGGGTTACAGGCATTTTGACACAGCCAGGATATATGGTTCTGAGGCTGCCCTGGGAAATGCTTTAACAGACGCAGTTCAAGATGGGACTGTAGAAAGAGAAGACATTTTTGTTACCTCTAAGTTATGGGGTAGTCATCATCATGACCCTGTTTCGGCTCTGAGACAAACTCTAAAATGGTTAGTGGAATGTAGGTTGATATTGTGGACTTCAATGGTAGCTTTTTGGCTTGTGTGTGTGATTTGGCTGGTGCAAATCCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00010 ko00040 ko00561 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00561 map00930 map01100 map01110 map01120 map01130 map01220
Pfam Domains
Protein Families
Aldo_ket_red

Protein Analysis

98

Amino Acids

11.24

Weight (kDa)

6.38

Isoelectric Point (pI)

29.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldo_ket_red PF00248 9 - 59 9.1e-09 Aldo/keto reductase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022439)

Species Orthologous Gene IDs
prunus_persica Prupe.2G276300_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0374851
rosa_samantha Rh1CG369200 Rh1CG374200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 2 cut(s) 113, 246
AjnI CCWGG 2 cut(s) 59, 84
AloI GAACNNNNNNTCC 2 cut(s) 55, 87
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
Alw26I GTCTC 1 cut(s) 190
ApeKI GCWGC 1 cut(s) 80
BbsI GAAGAC 1 cut(s) 141
BbvI GCAGC 1 cut(s) 67
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 2 cut(s) 61, 86
BcoDI GTCTC 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 2 cut(s) 61, 86
BmrFI CCNGG 2 cut(s) 61, 86
BpiI GAAGAC 1 cut(s) 141
BplI GAGNNNNNCTC 2 cut(s) 187, 219
BsaJI CCNNGG 2 cut(s) 84, 85
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 2 cut(s) 61, 86
BseDI CCNNGG 2 cut(s) 84, 85
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 2 cut(s) 66, 185
BseXI GCAGC 1 cut(s) 67
BslFI GGGAC 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 133
BspCNI CTCAG 2 cut(s) 67, 186
BspHI TCATGA 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 84, 85
Bst2UI CCWGG 2 cut(s) 61, 86
Bst4CI ACNGT 1 cut(s) 124
BstDEI CTNAG 3 cut(s) 75, 153, 194
BstMAI GTCTC 1 cut(s) 190
BstNI CCWGG 2 cut(s) 61, 86
BstSCI CCNGG 2 cut(s) 59, 84
BstSFI CTRYAG 1 cut(s) 123
BstV1I GCAGC 1 cut(s) 67
BstV2I GAAGAC 1 cut(s) 141
CciI TCATGA 1 cut(s) 175
CseI GACGC 1 cut(s) 113
CviAII CATG 1 cut(s) 176
CviJI RGCY 7 cut(s) 26, 59, 80, 191, 254, 262, 280
CviKI_1 RGCY 7 cut(s) 26, 59, 80, 191, 254, 262, 280
DdeI CTNAG 3 cut(s) 75, 153, 194
EcoRII CCWGG 2 cut(s) 59, 84
FaeI CATG 1 cut(s) 179
FaiI YATR 4 cut(s) 67, 69, 160, 177
FaqI GGGAC 1 cut(s) 133
FatI CATG 1 cut(s) 175
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
GluI GCNGC 1 cut(s) 81
HgaI GACGC 1 cut(s) 113
Hin1II CATG 1 cut(s) 179
HinfI GANTC 1 cut(s) 12
Hpy166II GTNNAC 1 cut(s) 240
Hpy188I TCNGA 3 cut(s) 76, 195, 293
Hpy188III TCNNGA 2 cut(s) 113, 176
Hpy8I GTNNAC 1 cut(s) 240
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 286
HpyF3I CTNAG 3 cut(s) 75, 153, 194
Hsp92II CATG 1 cut(s) 179
LpnPI CCDG 8 cut(s) 28, 36, 46, 71, 73, 98, 195, 266
Lsp1109I GCAGC 1 cut(s) 67
MaeIII GTNAC 2 cut(s) 38, 145
MboII GAAGA 1 cut(s) 146
MluCI AATT 1 cut(s) 18
MnlI CCTC 2 cut(s) 70, 160
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 174
MspR9I CCNGG 2 cut(s) 61, 86
MvaI CCWGG 2 cut(s) 61, 86
NlaIII CATG 1 cut(s) 179
PagI TCATGA 1 cut(s) 175
PasI CCCWGGG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 12
PkrI GCNGC 1 cut(s) 82
Psp6I CCWGG 2 cut(s) 59, 84
PspGI CCWGG 2 cut(s) 59, 84
RseI CAYNNNNRTG 1 cut(s) 174
SaqAI TTAA 1 cut(s) 98
SatI GCNGC 1 cut(s) 81
ScrFI CCNGG 2 cut(s) 61, 86
SetI ASST 3 cut(s) 152, 230, 256
SfcI CTRYAG 1 cut(s) 123
SmiMI CAYNNNNRTG 1 cut(s) 174
Sse9I AATT 1 cut(s) 18
StyD4I CCNGG 2 cut(s) 59, 84
TaaI ACNGT 1 cut(s) 124
TasI AATT 1 cut(s) 18
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseI GCWGC 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.