Rh1CG374200

Aldo-keto reductase family 4 member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0022439
Physical Location & Seq
Forward (+)
64336766 .. 64337561
796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG374200.1

Sequence Viewer

Length: 213 bp
ATGATATTTGGATTCTCAATTCCAGCCTTTCCAATGGGTTACAGGCATTTTGACACAGCCAGGATTTATGGTTCTGAGGCCGCCCTGGGAAATGCTTTAACAGAGGCAGTTCAAGACGGGACTGTAGAAAGAGAAGACATTTTTGTTACCTCTAAGTTATGGGGTAGTCATCATCATGACCCTCTTTCGGCTCTGAGACAAACTCTAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00010 ko00040 ko00561 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00561 map00930 map01100 map01110 map01120 map01130 map01220
Pfam Domains
Protein Families
Aldo_ket_red

Protein Analysis

70

Amino Acids

7.81

Weight (kDa)

6.01

Isoelectric Point (pI)

22.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldo_ket_red PF00248 9 - 58 5.2e-09 Aldo/keto reductase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022439)

Species Orthologous Gene IDs
prunus_persica Prupe.2G276300_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0374851
rosa_samantha Rh1CG369200 Rh1CG374200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 81
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 1 cut(s) 113
AjnI CCWGG 2 cut(s) 59, 84
AloI GAACNNNNNNTCC 2 cut(s) 55, 87
Alw26I GTCTC 1 cut(s) 190
AoxI GGCC 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 141
BciT130I CCWGG 2 cut(s) 61, 86
BcoDI GTCTC 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 2 cut(s) 61, 86
BmrFI CCNGG 2 cut(s) 61, 86
BpiI GAAGAC 1 cut(s) 141
BplI GAGNNNNNCTC 1 cut(s) 187
BsaJI CCNNGG 2 cut(s) 84, 85
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 2 cut(s) 61, 86
BseDI CCNNGG 2 cut(s) 84, 85
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 2 cut(s) 66, 185
BshFI GGCC 1 cut(s) 80
BslFI GGGAC 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 133
BsnI GGCC 1 cut(s) 80
BspACI CCGC 1 cut(s) 81
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 2 cut(s) 67, 186
BspHI TCATGA 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 84, 85
Bst2UI CCWGG 2 cut(s) 61, 86
Bst4CI ACNGT 1 cut(s) 124
BstDEI CTNAG 3 cut(s) 75, 153, 194
BstMAI GTCTC 1 cut(s) 190
BstNI CCWGG 2 cut(s) 61, 86
BstSCI CCNGG 2 cut(s) 59, 84
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 141
BsuRI GGCC 1 cut(s) 80
CciI TCATGA 1 cut(s) 175
CviAII CATG 1 cut(s) 176
CviJI RGCY 4 cut(s) 26, 59, 80, 191
CviKI_1 RGCY 4 cut(s) 26, 59, 80, 191
DdeI CTNAG 3 cut(s) 75, 153, 194
EcoRII CCWGG 2 cut(s) 59, 84
FaeI CATG 1 cut(s) 179
FaiI YATR 3 cut(s) 69, 160, 177
FaqI GGGAC 1 cut(s) 133
FatI CATG 1 cut(s) 175
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 80
Hin1II CATG 1 cut(s) 179
HinfI GANTC 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 76, 195
Hpy188III TCNNGA 2 cut(s) 113, 176
HpyCH4III ACNGT 1 cut(s) 124
HpyF3I CTNAG 3 cut(s) 75, 153, 194
Hsp92II CATG 1 cut(s) 179
LpnPI CCDG 6 cut(s) 28, 36, 46, 71, 73, 98
MaeIII GTNAC 2 cut(s) 38, 145
MboII GAAGA 1 cut(s) 146
MluCI AATT 1 cut(s) 18
MnlI CCTC 4 cut(s) 70, 97, 160, 192
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 174
MspR9I CCNGG 2 cut(s) 61, 86
MvaI CCWGG 2 cut(s) 61, 86
NlaIII CATG 1 cut(s) 179
PagI TCATGA 1 cut(s) 175
PasI CCCWGGG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 12
PkrI GCNGC 1 cut(s) 82
Psp6I CCWGG 2 cut(s) 59, 84
PspGI CCWGG 2 cut(s) 59, 84
RseI CAYNNNNRTG 1 cut(s) 174
SaqAI TTAA 1 cut(s) 98
SatI GCNGC 1 cut(s) 81
ScrFI CCNGG 2 cut(s) 61, 86
SetI ASST 1 cut(s) 152
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 9 cut(s) 35, 55, 72, 73, 97, 98, 125, 130, 188
SmiMI CAYNNNNRTG 1 cut(s) 174
Sse9I AATT 1 cut(s) 18
SsiI CCGC 1 cut(s) 81
StyD4I CCNGG 2 cut(s) 59, 84
TaaI ACNGT 1 cut(s) 124
TasI AATT 1 cut(s) 18
TauI GCSGC 1 cut(s) 83
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.