RchiOBHm_Chr1g0380461

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66119567 .. 66123486
3920 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60373

Sequence Viewer

Length: 210 bp
ATGGTCCTGTGCTTGTGGAAGACACTTGCCTCTGCTTCAATGCCCTCAAGGGTCTACCTGGGCCTTACATGTTCACTACTAGAGCAGGAGAGAGACCTGGAGGGTGCAGCAGCTAAACATAAGAGAAAGCAGGCTTCATCAAACTTTGAACAGACCTCTAGTATAGATGGTATGGTTTATGTTTTTTGTTCGGTTGGATCATGTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.53

Weight (kDa)

7.66

Isoelectric Point (pI)

54.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020470)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 54
AclWI GGATC 1 cut(s) 205
AflIII ACRYGT 1 cut(s) 68
AgsI TTSAA 2 cut(s) 39, 149
AjnI CCWGG 2 cut(s) 57, 96
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 87
AlwI GGATC 1 cut(s) 205
AoxI GGCC 1 cut(s) 61
ApeKI GCWGC 2 cut(s) 107, 110
AspS9I GGNCC 2 cut(s) 4, 61
AvaII GGWCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 26
BbvI GCAGC 2 cut(s) 119, 122
BccI CCATC 1 cut(s) 161
BciT130I CCWGG 2 cut(s) 59, 98
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 2 cut(s) 80, 159
BisI GCNGC 2 cut(s) 108, 111
BlsI GCNGC 2 cut(s) 109, 112
Bme1390I CCNGG 2 cut(s) 59, 98
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 61
BmrFI CCNGG 2 cut(s) 59, 98
BpiI GAAGAC 1 cut(s) 26
BpmI CTGGAG 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 31
BsaI GGTCTC 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 58
BseBI CCWGG 2 cut(s) 59, 98
BseDI CCNNGG 1 cut(s) 58
BseXI GCAGC 2 cut(s) 119, 122
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 63
BsmAI GTCTC 1 cut(s) 87
BsnI GGCC 1 cut(s) 63
Bso31I GGTCTC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 197
BspANI GGCC 1 cut(s) 63
BspPI GGATC 1 cut(s) 205
BspTNI GGTCTC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 1 cut(s) 197
Bst2UI CCWGG 2 cut(s) 59, 98
BstC8I GCNNGC 1 cut(s) 132
BstKTI GATC 1 cut(s) 200
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 1 cut(s) 197
BstNI CCWGG 2 cut(s) 59, 98
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 2 cut(s) 57, 96
BstV1I GCAGC 2 cut(s) 119, 122
BstV2I GAAGAC 1 cut(s) 26
BsuRI GGCC 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 4, 61
CviAII CATG 2 cut(s) 69, 201
CviJI RGCY 3 cut(s) 63, 113, 134
CviKI_1 RGCY 3 cut(s) 63, 113, 134
DpnI GATC 1 cut(s) 199
DpnII GATC 1 cut(s) 197
Eco31I GGTCTC 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 2 cut(s) 57, 96
FaeI CATG 2 cut(s) 72, 204
FaiI YATR 6 cut(s) 70, 120, 164, 173, 180, 202
FatI CATG 2 cut(s) 68, 200
FblI GTMKAC 1 cut(s) 54
Fnu4HI GCNGC 2 cut(s) 108, 111
Fsp4HI GCNGC 2 cut(s) 108, 111
FspBI CTAG 2 cut(s) 80, 159
GluI GCNGC 2 cut(s) 108, 111
GsuI CTGGAG 1 cut(s) 119
HaeIII GGCC 1 cut(s) 63
Hin1II CATG 2 cut(s) 72, 204
Hpy166II GTNNAC 2 cut(s) 55, 74
Hpy8I GTNNAC 2 cut(s) 55, 74
HpyCH4V TGCA 1 cut(s) 107
Hsp92II CATG 2 cut(s) 72, 204
Kzo9I GATC 1 cut(s) 197
LpnPI CCDG 7 cut(s) 20, 44, 71, 71, 83, 110, 116
Lsp1109I GCAGC 2 cut(s) 119, 122
MaeI CTAG 2 cut(s) 80, 159
MalI GATC 1 cut(s) 199
MboI GATC 1 cut(s) 197
MboII GAAGA 1 cut(s) 31
MmeI TCCRAC 1 cut(s) 175
MnlI CCTC 4 cut(s) 40, 55, 94, 166
MspR9I CCNGG 2 cut(s) 59, 98
MvaI CCWGG 2 cut(s) 59, 98
NdeII GATC 1 cut(s) 197
NlaIII CATG 2 cut(s) 72, 204
NspI RCATGY 1 cut(s) 72
PciI ACATGT 1 cut(s) 68
PkrI GCNGC 2 cut(s) 109, 112
PscI ACATGT 1 cut(s) 68
Psp6I CCWGG 2 cut(s) 57, 96
PspGI CCWGG 2 cut(s) 57, 96
PspPI GGNCC 2 cut(s) 4, 61
SatI GCNGC 2 cut(s) 108, 111
Sau3AI GATC 1 cut(s) 197
Sau96I GGNCC 2 cut(s) 4, 61
ScrFI CCNGG 2 cut(s) 59, 98
SetI ASST 4 cut(s) 60, 99, 115, 158
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
SspMI CTAG 2 cut(s) 80, 159
StyD4I CCNGG 2 cut(s) 57, 96
TseI GCWGC 2 cut(s) 107, 110
TspDTI ATGAA 1 cut(s) 126
VpaK11BI GGWCC 1 cut(s) 4
XceI RCATGY 1 cut(s) 72
XmiI GTMKAC 1 cut(s) 54
XspI CTAG 2 cut(s) 80, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.