RchiOBHm_Chr2g0086181

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
1337337 .. 1338178
842 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46171

Sequence Viewer

Length: 201 bp
ATGAAGTATGAGAATCCACCTCTACTAATAGTGGACATAGGACCACAAACATCTGTATGTATTAGGCCTAGGAGTTCATTAACTCTTGTTCTTTGTCCACTAAAATGTGACTTGGTCATTTTTCCTTTTAGACAAGACTCACAAGTAGGCATAGGATCAGATCCTAATGACTCTAAGTATCCATTTTTGGATAATTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.38

Weight (kDa)

4.92

Isoelectric Point (pI)

47.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024656)

Species Orthologous Gene IDs
pyrus_communis pycom08g03660 pycom17g16770
rosa_chinensis RchiOBHm_Chr2g0086181

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 155, 163
AlwI GGATC 2 cut(s) 155, 163
AoxI GGCC 1 cut(s) 65
AspA2I CCTAGG 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
AvrII CCTAGG 1 cut(s) 68
BciVI GTATCC 1 cut(s) 189
BfaI CTAG 1 cut(s) 69
BfuI GTATCC 1 cut(s) 189
BlnI CCTAGG 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 68
BshFI GGCC 1 cut(s) 67
BsnI GGCC 1 cut(s) 67
Bsp143I GATC 2 cut(s) 155, 160
BspANI GGCC 1 cut(s) 67
BspPI GGATC 2 cut(s) 155, 163
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 2 cut(s) 155, 160
BssT1I CCWWGG 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 2 cut(s) 158, 163
BstMBI GATC 2 cut(s) 155, 160
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
BsuI GTATCC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 41
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 157, 162
DpnII GATC 2 cut(s) 155, 160
Eco130I CCWWGG 1 cut(s) 68
Eco147I AGGCCT 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 68
FaiI YATR 4 cut(s) 9, 38, 58, 152
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 67
HinfI GANTC 3 cut(s) 13, 137, 170
Hpy166II GTNNAC 2 cut(s) 34, 98
Hpy188I TCNGA 1 cut(s) 160
Hpy8I GTNNAC 2 cut(s) 34, 98
HpyF3I CTNAG 1 cut(s) 174
Kzo9I GATC 2 cut(s) 155, 160
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 107
MalI GATC 2 cut(s) 157, 162
MboI GATC 2 cut(s) 155, 160
MflI RGATCY 1 cut(s) 160
MluCI AATT 1 cut(s) 193
MlyI GAGTC 2 cut(s) 131, 164
MnlI CCTC 1 cut(s) 30
MseI TTAA 1 cut(s) 80
MslI CAYNNNNRTG 2 cut(s) 55, 103
NdeII GATC 2 cut(s) 155, 160
NmuCI GTSAC 1 cut(s) 107
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 113
PleI GAGTC 2 cut(s) 131, 164
PpsI GAGTC 2 cut(s) 131, 164
PspPI GGNCC 1 cut(s) 41
PsuI RGATCY 1 cut(s) 160
PsyI GACNNNGTC 1 cut(s) 113
RseI CAYNNNNRTG 2 cut(s) 55, 103
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 2 cut(s) 155, 160
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 2 cut(s) 131, 164
SetI ASST 1 cut(s) 22
SgeI CNNG 5 cut(s) 81, 98, 124, 146, 155
SinI GGWCC 1 cut(s) 41
SmiMI CAYNNNNRTG 2 cut(s) 55, 103
Sse9I AATT 1 cut(s) 193
SseBI AGGCCT 1 cut(s) 67
SspMI CTAG 1 cut(s) 69
StuI AGGCCT 1 cut(s) 67
StyI CCWWGG 1 cut(s) 68
TasI AATT 1 cut(s) 193
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 17, 66
Tth111I GACNNNGTC 1 cut(s) 113
VpaK11BI GGWCC 1 cut(s) 41
XmaJI CCTAGG 1 cut(s) 68
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.