RchiOBHm_Chr2g0109421

Auxin-binding protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
20794592 .. 20794909
318 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48324

Sequence Viewer

Length: 318 bp
ATGCACTCTCACCGTGGAGCTTCAGAGGCCATACTTGTTGCAAAAGGCAAAGTTATATTTGATAACGAAGCTTATGTTAAAACACTGAAGAAATGTGATATTATGGTTTTACCTCAAGGTTTGCTTCACTTCCAAGTAAATGCAGGTGATACTCCAGCCCTTATATTTGCTAGCTTCAGTAGTAATGACCCAGGTGTGCATGTTTTGGAGACTGCACTGTTTCAAAACGATTTACATACTGAATTGATAGCACAGACTACTCTCCTTGACATTGCTGAGATTAAGAAACTTAAGGGTCTTCTTGGTACTACTAATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.4

Weight (kDa)

6.16

Isoelectric Point (pI)

18.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cupin_1 PF00190 1 - 93 3e-15 Cupin
Cupin_2 PF07883 1 - 56 8.7e-06 Cupin domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024831)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0109421
rosa_laevigata RLG00000017737
rosa_roxburghii Rroxscaffold_2G00134250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 134
Acc36I ACCTGC 1 cut(s) 134
AcuI CTGAAG 3 cut(s) 6, 107, 160
AfaI GTAC 1 cut(s) 307
AflII CTTAAG 1 cut(s) 290
AgsI TTSAA 1 cut(s) 224
AjnI CCWGG 1 cut(s) 190
AluBI AGCT 3 cut(s) 20, 71, 174
AluI AGCT 3 cut(s) 20, 71, 174
Alw26I GTCTC 1 cut(s) 203
AoxI GGCC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 158
AsuNHI GCTAGC 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 290
BciT130I CCWGG 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 203
BfaI CTAG 1 cut(s) 171
BfrI CTTAAG 1 cut(s) 290
BfuAI ACCTGC 1 cut(s) 134
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BmtI GCTAGC 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 290
BpmI CTGGAG 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 13, 190
Bse3DI GCAATG 1 cut(s) 270
BseBI CCWGG 1 cut(s) 192
BseDI CCNNGG 2 cut(s) 13, 190
BseMI GCAATG 1 cut(s) 270
BseMII CTCAG 1 cut(s) 267
BsgI GTGCAG 1 cut(s) 198
BshFI GGCC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 203
BsnI GGCC 1 cut(s) 29
BspANI GGCC 1 cut(s) 29
BspCNI CTCAG 1 cut(s) 268
BspMI ACCTGC 1 cut(s) 134
BspOI GCTAGC 1 cut(s) 174
BspTI CTTAAG 1 cut(s) 290
BsrDI GCAATG 1 cut(s) 270
BssECI CCNNGG 2 cut(s) 13, 190
Bst2UI CCWGG 1 cut(s) 192
Bst4CI ACNGT 2 cut(s) 14, 219
BstAFI CTTAAG 1 cut(s) 290
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 276
BstDSI CCRYGG 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 203
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 192
BstNSI RCATGY 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 290
BsuRI GGCC 1 cut(s) 29
BtgI CCRYGG 1 cut(s) 13
BtsIMutI CAGTG 2 cut(s) 83, 215
BveI ACCTGC 1 cut(s) 134
Cac8I GCNNGC 1 cut(s) 172
Csp6I GTAC 1 cut(s) 306
CviAII CATG 1 cut(s) 200
CviJI RGCY 5 cut(s) 20, 29, 71, 158, 174
CviKI_1 RGCY 5 cut(s) 20, 29, 71, 158, 174
CviQI GTAC 1 cut(s) 306
DdeI CTNAG 1 cut(s) 276
Eco57I CTGAAG 3 cut(s) 6, 107, 160
EcoRII CCWGG 1 cut(s) 190
FaeI CATG 1 cut(s) 203
FaiI YATR 7 cut(s) 32, 56, 75, 104, 164, 201, 237
FalI AAGNNNNNCTT 2 cut(s) 108, 140
FatI CATG 1 cut(s) 199
FspBI CTAG 1 cut(s) 171
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 29
Hin1II CATG 1 cut(s) 203
HindIII AAGCTT 1 cut(s) 69
HphI GGTGA 1 cut(s) 158
Hpy188I TCNGA 1 cut(s) 25
HpyCH4III ACNGT 2 cut(s) 14, 219
HpyCH4V TGCA 5 cut(s) 4, 41, 143, 199, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 276
Hsp92II CATG 1 cut(s) 203
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 4 cut(s) 129, 168, 177, 204
MaeI CTAG 1 cut(s) 171
MboII GAAGA 2 cut(s) 100, 290
MluCI AATT 2 cut(s) 242, 313
MnlI CCTC 2 cut(s) 19, 123
MseI TTAA 3 cut(s) 78, 282, 291
MspCI CTTAAG 1 cut(s) 290
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 26
NheI GCTAGC 1 cut(s) 170
NlaIII CATG 1 cut(s) 203
NspI RCATGY 1 cut(s) 203
PaqCI CACCTGC 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
RsaI GTAC 1 cut(s) 307
RsaNI GTAC 1 cut(s) 306
SaqAI TTAA 3 cut(s) 78, 282, 291
ScrFI CCNGG 1 cut(s) 192
SetI ASST 7 cut(s) 22, 73, 115, 121, 148, 176, 196
SmlI CTYRAG 2 cut(s) 114, 290
SmoI CTYRAG 2 cut(s) 114, 290
Sse9I AATT 2 cut(s) 242, 313
SspMI CTAG 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 190
TaaI ACNGT 2 cut(s) 14, 219
TasI AATT 2 cut(s) 242, 313
Tru1I TTAA 3 cut(s) 78, 282, 291
Tru9I TTAA 3 cut(s) 78, 282, 291
TscAI CASTG 2 cut(s) 90, 222
TspRI CASTG 2 cut(s) 90, 222
Vha464I CTTAAG 1 cut(s) 290
XceI RCATGY 1 cut(s) 203
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.