RchiOBHm_Chr2g0150691

V-type proton ATPase subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0024865
Physical Location & Seq
Reverse (-)
68355487 .. 68355705
219 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51994

Sequence Viewer

Length: 219 bp
ATGTTGCCTGTTGGTGAGACGAGAGGTCATGCTCTCCTCAAGAAGAAAAGTGATGCTCTAACTGTGCAGTTTCGTACGATTCTTAAAAAGATTGTGTCAACCAAAGAATCAATGGGAGATATTATGAAAACCTCCTCCTTCGCCCTTACTGAAGCCAAGTATGTTGCTGGTGAGAACATCAAACACATTGTTCTCGAGAATGTCAACACTGCCTCTTAA

Protein Analysis

72

Amino Acids

7.89

Weight (kDa)

9.63

Isoelectric Point (pI)

24.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_D PF01813 7 - 71 2.7e-14 ATP synthase subunit D
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024865)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0150691
rosa_samantha Rh2DG504600 Rh2DG505600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 171
AfaI GTAC 1 cut(s) 76
AhdI GACNNNNNGTC 1 cut(s) 24
Alw26I GTCTC 1 cut(s) 11
Ama87I CYCGRG 1 cut(s) 194
AsuHPI GGTGA 2 cut(s) 26, 182
AvaI CYCGRG 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 11
BmeRI GACNNNNNGTC 1 cut(s) 24
BmeT110I CYCGRG 1 cut(s) 194
BmsI GCATC 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 23
BseRI GAGGAG 2 cut(s) 26, 124
BsgI GTGCAG 1 cut(s) 86
BsiHKCI CYCGRG 1 cut(s) 194
BsiWI CGTACG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 11
BsmBI CGTCTC 1 cut(s) 11
BsoBI CYCGRG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 11
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 207
Csp6I GTAC 1 cut(s) 75
CviAII CATG 1 cut(s) 29
CviJI RGCY 1 cut(s) 155
CviKI_1 RGCY 1 cut(s) 155
CviQI GTAC 1 cut(s) 75
DriI GACNNNNNGTC 1 cut(s) 24
Eam1105I GACNNNNNGTC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 171
Eco88I CYCGRG 1 cut(s) 194
Esp3I CGTCTC 1 cut(s) 11
FaeI CATG 1 cut(s) 32
FaiI YATR 3 cut(s) 30, 125, 162
FatI CATG 1 cut(s) 28
Hin1II CATG 1 cut(s) 32
HincII GTYRAC 2 cut(s) 99, 205
HindII GTYRAC 2 cut(s) 99, 205
HinfI GANTC 2 cut(s) 79, 107
HphI GGTGA 2 cut(s) 26, 182
Hpy166II GTNNAC 2 cut(s) 99, 205
Hpy188III TCNNGA 3 cut(s) 40, 194, 196
Hpy8I GTNNAC 2 cut(s) 99, 205
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 67
Hsp92II CATG 1 cut(s) 32
LpnPI CCDG 2 cut(s) 21, 153
LweI GCATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 55
MnlI CCTC 4 cut(s) 17, 47, 142, 145
MseI TTAA 2 cut(s) 84, 217
NlaIII CATG 1 cut(s) 32
PaeR7I CTCGAG 1 cut(s) 194
PfeI GAWTC 2 cut(s) 79, 107
Pfl23II CGTACG 1 cut(s) 74
PspLI CGTACG 1 cut(s) 74
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SaqAI TTAA 2 cut(s) 84, 217
SetI ASST 2 cut(s) 28, 134
SfaNI GCATC 1 cut(s) 43
Sfr274I CTCGAG 1 cut(s) 194
SgeI CNNG 8 cut(s) 20, 33, 41, 52, 169, 180, 206, 208
SlaI CTCGAG 1 cut(s) 194
SmlI CTYRAG 2 cut(s) 38, 194
SmoI CTYRAG 2 cut(s) 38, 194
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 195
TfiI GAWTC 2 cut(s) 79, 107
Tru1I TTAA 2 cut(s) 84, 217
Tru9I TTAA 2 cut(s) 84, 217
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 140
TspRI CASTG 1 cut(s) 214
XcmI CCANNNNNNNNNTGG 1 cut(s) 109
XhoI CTCGAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.