RchiOBHm_Chr2g0156401
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
73041383 .. 73041592
210 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52518

Sequence Viewer

Length: 210 bp
ATGCCAATCAAAATAAACATTGCACTAACAACTCTCACTGGTCTCATCCCCTCGTCTTTGGGGAACTTGACTGCTCTTGAATCTTTAGATCTCTCCCAAAATCGGCTCTCAGGAAAGATCCCCAATGATCTAGTAGAAAATAATACTTTGATTTTAGGGTTTTCAATAATAATGATATTCATCCCACAAAGGGTATATATACAAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.51

Weight (kDa)

5.97

Isoelectric Point (pI)

28.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021283)

Species Orthologous Gene IDs
pyrus_communis pycom14g01360
rosa_chinensis RchiOBHm_Chr1g0316141 RchiOBHm_Chr2g0156401
rosa_roxburghii Rroxscaffold_4G00322880
rosa_rugosa Rorug03G0166600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 112
AfiI CCNNNNNNNGG 2 cut(s) 102, 190
AgsI TTSAA 2 cut(s) 80, 165
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 1 cut(s) 112
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 1 cut(s) 131
BglII AGATCT 1 cut(s) 88
BsaBI GATNNNNATC 1 cut(s) 179
BsaI GGTCTC 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 102, 190
Bse1I ACTGG 1 cut(s) 43
Bse3DI GCAATG 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 179
BseGI GGATG 2 cut(s) 45, 180
BseJI GATNNNNATC 1 cut(s) 179
BseLI CCNNNNNNNGG 2 cut(s) 102, 190
BseMI GCAATG 1 cut(s) 18
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 43
BslI CCNNNNNNNGG 2 cut(s) 102, 190
BsmAI GTCTC 1 cut(s) 47
Bso31I GGTCTC 1 cut(s) 47
Bsp143I GATC 3 cut(s) 88, 117, 127
BspCNI CTCAG 1 cut(s) 122
BspPI GGATC 1 cut(s) 112
BspTNI GGTCTC 1 cut(s) 47
BsrDI GCAATG 1 cut(s) 18
BsrI ACTGG 1 cut(s) 43
BssMI GATC 3 cut(s) 88, 117, 127
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 2 cut(s) 45, 180
BstKTI GATC 3 cut(s) 91, 120, 130
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 3 cut(s) 88, 117, 127
BstX2I RGATCY 2 cut(s) 88, 117
BstYI RGATCY 2 cut(s) 88, 117
BtsCI GGATG 2 cut(s) 45, 180
BtsIMutI CAGTG 1 cut(s) 36
CviJI RGCY 1 cut(s) 106
CviKI_1 RGCY 1 cut(s) 106
DdeI CTNAG 1 cut(s) 109
DpnI GATC 3 cut(s) 90, 119, 129
DpnII GATC 3 cut(s) 88, 117, 127
Eco31I GGTCTC 1 cut(s) 47
FaiI YATR 3 cut(s) 196, 198, 200
FokI GGATG 2 cut(s) 32, 167
FspBI CTAG 1 cut(s) 131
HinfI GANTC 1 cut(s) 80
Hpy188III TCNNGA 2 cut(s) 77, 111
HpyCH4V TGCA 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 109
Kzo9I GATC 3 cut(s) 88, 117, 127
LpnPI CCDG 2 cut(s) 24, 96
MaeI CTAG 1 cut(s) 131
MalI GATC 3 cut(s) 90, 119, 129
MboI GATC 3 cut(s) 88, 117, 127
MflI RGATCY 2 cut(s) 88, 117
MnlI CCTC 1 cut(s) 61
NdeII GATC 3 cut(s) 88, 117, 127
PfeI GAWTC 1 cut(s) 80
PsuI RGATCY 2 cut(s) 88, 117
Sau3AI GATC 3 cut(s) 88, 117, 127
SgeI CNNG 6 cut(s) 51, 64, 79, 89, 123, 143
SspMI CTAG 1 cut(s) 131
TfiI GAWTC 1 cut(s) 80
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 169
TspRI CASTG 1 cut(s) 43
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.