RchiOBHm_Chr2g0174511

F-box protein At5g07610-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
87070653 .. 87078515
7863 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54166

Sequence Viewer

Length: 225 bp
ATGGTGCAGAGATTCTACCCCAAACGCTGCAGCAGCTGCTGCTTAGCAGAAACCATAGCCAACACTGAAGAACTCCTTACCGAAATCCTTGTGCGTGTGCCAGCTACACCTCTGGTCCGCTTCAAATGTGTCTCCAAGCACTGGCTCTCTTATTTCCGACCCCAAATTCTGTCACCGCCACACCCTTCAAAACCCAAACACTCCCATCTCTGCCGTCTTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.6

Weight (kDa)

9.6

Isoelectric Point (pI)

64.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024849)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0174511
rosa_multiflora Rmu_sc0001533.1_g000004
rosa_rugosa Rorug02G0001500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 141
AciI CCGC 2 cut(s) 118, 176
AcsI RAATTY 1 cut(s) 165
AcuI CTGAAG 1 cut(s) 87
AfiI CCNNNNNNNGG 1 cut(s) 141
AgsI TTSAA 2 cut(s) 124, 189
AluBI AGCT 2 cut(s) 36, 104
AluI AGCT 2 cut(s) 36, 104
Alw26I GTCTC 1 cut(s) 136
AlwNI CAGNNNCTG 2 cut(s) 36, 39
ApeKI GCWGC 5 cut(s) 27, 30, 33, 36, 39
ApoI RAATTY 1 cut(s) 165
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 165
AvaII GGWCC 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 209
BbvI GCAGC 5 cut(s) 14, 23, 26, 42, 45
BccI CCATC 1 cut(s) 213
BceAI ACGGC 1 cut(s) 198
BcoDI GTCTC 1 cut(s) 136
BfmI CTRYAG 1 cut(s) 28
BisI GCNGC 5 cut(s) 28, 31, 34, 37, 40
BlpI GCTNAGC 1 cut(s) 43
BlsI GCNGC 5 cut(s) 29, 32, 35, 38, 41
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 209
Bpu1102I GCTNAGC 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 141
Bse1I ACTGG 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 146
BseXI GCAGC 5 cut(s) 14, 23, 26, 42, 45
BsgI GTGCAG 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 136
Bsp1720I GCTNAGC 1 cut(s) 43
BspACI CCGC 2 cut(s) 118, 176
BspMAI CTGCAG 1 cut(s) 32
BsrI ACTGG 1 cut(s) 146
BstAPI GCANNNNNTGC 2 cut(s) 36, 39
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 136
BstMWI GCNNNNNNNGC 3 cut(s) 33, 36, 39
BstSFI CTRYAG 1 cut(s) 28
BstV1I GCAGC 5 cut(s) 14, 23, 26, 42, 45
BstV2I GAAGAC 1 cut(s) 209
BtsIMutI CAGTG 2 cut(s) 63, 139
Cac8I GCNNGC 1 cut(s) 102
CaiI CAGNNNCTG 2 cut(s) 36, 39
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 4 cut(s) 36, 59, 104, 145
CviKI_1 RGCY 4 cut(s) 36, 59, 104, 145
DdeI CTNAG 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 87
FaiI YATR 1 cut(s) 56
FalI AAGNNNNNCTT 2 cut(s) 60, 92
Fnu4HI GCNGC 5 cut(s) 28, 31, 34, 37, 40
Fsp4HI GCNGC 5 cut(s) 28, 31, 34, 37, 40
GluI GCNGC 5 cut(s) 28, 31, 34, 37, 40
HinfI GANTC 1 cut(s) 12
HphI GGTGA 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 195
HpyCH4V TGCA 2 cut(s) 7, 30
HpyF10VI GCNNNNNNNGC 3 cut(s) 33, 36, 39
HpyF3I CTNAG 1 cut(s) 43
LpnPI CCDG 3 cut(s) 98, 114, 127
Lsp1109I GCAGC 5 cut(s) 14, 23, 26, 42, 45
MaeIII GTNAC 1 cut(s) 171
MboII GAAGA 2 cut(s) 80, 209
MluCI AATT 1 cut(s) 165
MmeI TCCRAC 1 cut(s) 181
MnlI CCTC 1 cut(s) 120
MspA1I CMGCKG 1 cut(s) 36
MwoI GCNNNNNNNGC 3 cut(s) 33, 36, 39
NmuCI GTSAC 1 cut(s) 171
PfeI GAWTC 1 cut(s) 12
PflMI CCANNNNNTGG 1 cut(s) 141
PkrI GCNGC 5 cut(s) 29, 32, 35, 38, 41
PspPI GGNCC 1 cut(s) 115
PstI CTGCAG 1 cut(s) 32
PstNI CAGNNNCTG 2 cut(s) 36, 39
PvuII CAGCTG 1 cut(s) 36
SatI GCNGC 5 cut(s) 28, 31, 34, 37, 40
Sau96I GGNCC 1 cut(s) 115
SetI ASST 3 cut(s) 38, 106, 112
SfcI CTRYAG 1 cut(s) 28
SgeI CNNG 6 cut(s) 101, 107, 113, 125, 148, 154
SinI GGWCC 1 cut(s) 115
Sse9I AATT 1 cut(s) 165
SsiI CCGC 2 cut(s) 118, 176
TasI AATT 1 cut(s) 165
TfiI GAWTC 1 cut(s) 12
TscAI CASTG 2 cut(s) 70, 146
TseFI GTSAC 1 cut(s) 171
TseI GCWGC 5 cut(s) 27, 30, 33, 36, 39
Tsp45I GTSAC 1 cut(s) 171
TspRI CASTG 2 cut(s) 70, 146
Van91I CCANNNNNTGG 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.