Rmu_sc0001533.1_g000004

F-box protein At5g07610-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001533.1
Physical Location & Seq
Reverse (-)
11164 .. 11913
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001533.1_g000004.1.cds

Sequence Viewer

Length: 750 bp
atggtgcagagattctaccccaaacgctgcagcagctgctgcttagcagaaaccatagccaacactgaagaactccttaccgaaatccttgtgcgtgtgccagctacacctctggtccgcttcaaatgtgtctccaagcactggctctctcttatcttccaccccaaattctgtcaccgccacacccttcaaaacccaaacactcccatctctgccgtcttccgtgacacatcccacccccccttttgtttcgtccttcttcctctggatgatcatcatacccgtagtagtaaccatgataaccaaaacccatctgggtcaggttcacccttcagtcctctcagtgtagttcaaagccaatacaatgatcacatcagagttatccagtcctgcaacggcctcttcttgtgccatcttttgagtgcaaaagaagtgaaccccccatattttattctcaatcccacaaccaaccagttctccacacttattcctccagctactactgttactaacgatgctggtcaacaagtagaaccctatatcatcagtattgctttggcttttgacccttccaaatcacctcattacaaggctttggctggaactctactaggtgaagcagcttcaatttcagttttcgactcgatttcggaaacttcaagcttggtaagttgctgccatctttcttgcttcgatttctgggttcgaattgcatctgtttcttttgctatacgctatacatatgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

249

Amino Acids

27.74

Weight (kDa)

6.84

Isoelectric Point (pI)

52.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024849)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0174511
rosa_multiflora Rmu_sc0001533.1_g000004
rosa_rugosa Rorug02G0001500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 141
AciI CCGC 2 cut(s) 118, 178
AcsI RAATTY 1 cut(s) 167
AcuI CTGAAG 2 cut(s) 87, 316
AfiI CCNNNNNNNGG 1 cut(s) 141
AgsI TTSAA 5 cut(s) 124, 191, 353, 627, 660
AluBI AGCT 5 cut(s) 36, 104, 497, 623, 663
AluI AGCT 5 cut(s) 36, 104, 497, 623, 663
Alw26I GTCTC 1 cut(s) 136
AlwNI CAGNNNCTG 2 cut(s) 36, 39
AoxI GGCC 1 cut(s) 397
ApeKI GCWGC 7 cut(s) 27, 30, 33, 36, 39, 620, 675
ApoI RAATTY 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 4 cut(s) 167, 318, 570, 626
AsuII TTCGAA 1 cut(s) 706
AvaII GGWCC 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 211
BbvI GCAGC 7 cut(s) 14, 23, 26, 42, 45, 632, 662
BccI CCATC 4 cut(s) 215, 319, 420, 687
BceAI ACGGC 2 cut(s) 200, 412
BclI TGATCA 2 cut(s) 271, 367
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 1 cut(s) 611
BfmI CTRYAG 1 cut(s) 28
BisI GCNGC 7 cut(s) 28, 31, 34, 37, 40, 621, 676
BlpI GCTNAGC 1 cut(s) 43
BlsI GCNGC 7 cut(s) 29, 32, 35, 38, 41, 622, 677
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmsI GCATC 2 cut(s) 505, 722
BpiI GAAGAC 1 cut(s) 211
BpmI CTGGAG 1 cut(s) 477
Bpu1102I GCTNAGC 1 cut(s) 43
Bpu14I TTCGAA 1 cut(s) 706
BsaBI GATNNNNATC 1 cut(s) 273
BsaXI ACNNNNNCTCC 2 cut(s) 461, 491
Bsc4I CCNNNNNNNGG 1 cut(s) 141
Bse1I ACTGG 3 cut(s) 146, 385, 472
Bse8I GATNNNNATC 1 cut(s) 273
BseGI GGATG 2 cut(s) 230, 274
BseJI GATNNNNATC 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 355
BseNI ACTGG 3 cut(s) 146, 385, 472
BseXI GCAGC 7 cut(s) 14, 23, 26, 42, 45, 632, 662
BsgI GTGCAG 1 cut(s) 26
BshFI GGCC 1 cut(s) 399
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 136
BsnI GGCC 1 cut(s) 399
Bsp119I TTCGAA 1 cut(s) 706
Bsp143I GATC 2 cut(s) 271, 367
Bsp1720I GCTNAGC 1 cut(s) 43
BspACI CCGC 2 cut(s) 118, 178
BspANI GGCC 1 cut(s) 399
BspCNI CTCAG 1 cut(s) 354
BspMAI CTGCAG 1 cut(s) 32
BspT104I TTCGAA 1 cut(s) 706
BsrI ACTGG 3 cut(s) 146, 385, 472
BssMI GATC 2 cut(s) 271, 367
Bst4CI ACNGT 1 cut(s) 505
Bst6I CTCTTC 1 cut(s) 407
BstAPI GCANNNNNTGC 2 cut(s) 36, 39
BstBI TTCGAA 1 cut(s) 706
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 2 cut(s) 43, 341
BstF5I GGATG 2 cut(s) 230, 274
BstKTI GATC 2 cut(s) 274, 370
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 2 cut(s) 271, 367
BstMWI GCNNNNNNNGC 3 cut(s) 33, 36, 39
BstSFI CTRYAG 1 cut(s) 28
BstV1I GCAGC 7 cut(s) 14, 23, 26, 42, 45, 632, 662
BstV2I GAAGAC 1 cut(s) 211
BsuRI GGCC 1 cut(s) 399
BtsCI GGATG 2 cut(s) 230, 274
BtsIMutI CAGTG 3 cut(s) 63, 139, 349
Cac8I GCNNGC 1 cut(s) 102
CaiI CAGNNNCTG 2 cut(s) 36, 39
Cfr13I GGNCC 1 cut(s) 115
CviAII CATG 1 cut(s) 296
DdeI CTNAG 2 cut(s) 43, 341
DpnI GATC 2 cut(s) 273, 369
DpnII GATC 2 cut(s) 271, 367
Eam1104I CTCTTC 1 cut(s) 407
EarI CTCTTC 1 cut(s) 407
Eco47I GGWCC 1 cut(s) 115
Eco57I CTGAAG 2 cut(s) 87, 316
FaeI CATG 1 cut(s) 299
FaiI YATR 9 cut(s) 56, 279, 297, 445, 540, 731, 738, 742, 744
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 1 cut(s) 295
FauNDI CATATG 1 cut(s) 742
FbaI TGATCA 2 cut(s) 271, 367
Fnu4HI GCNGC 7 cut(s) 28, 31, 34, 37, 40, 621, 676
FokI GGATG 2 cut(s) 217, 281
Fsp4HI GCNGC 7 cut(s) 28, 31, 34, 37, 40, 621, 676
FspBI CTAG 1 cut(s) 611
GluI GCNGC 7 cut(s) 28, 31, 34, 37, 40, 621, 676
GsuI CTGGAG 1 cut(s) 477
HaeIII GGCC 1 cut(s) 399
Hin1II CATG 1 cut(s) 299
HincII GTYRAC 1 cut(s) 524
HindII GTYRAC 1 cut(s) 524
HindIII AAGCTT 1 cut(s) 661
HinfI GANTC 2 cut(s) 12, 641
HphI GGTGA 4 cut(s) 167, 318, 570, 626
Hpy166II GTNNAC 3 cut(s) 326, 436, 524
Hpy188I TCNGA 2 cut(s) 377, 652
Hpy188III TCNNGA 1 cut(s) 266
Hpy8I GTNNAC 3 cut(s) 326, 436, 524
HpyAV CCTTC 4 cut(s) 197, 266, 340, 579
HpyCH4III ACNGT 1 cut(s) 505
HpyCH4V TGCA 5 cut(s) 7, 30, 393, 425, 713
HpyF10VI GCNNNNNNNGC 3 cut(s) 33, 36, 39
HpyF3I CTNAG 2 cut(s) 43, 341
Hsp92II CATG 1 cut(s) 299
Ksp22I TGATCA 2 cut(s) 271, 367
Kzo9I GATC 2 cut(s) 271, 367
Lsp1109I GCAGC 7 cut(s) 14, 23, 26, 42, 45, 632, 662
LweI GCATC 2 cut(s) 505, 722
MaeI CTAG 1 cut(s) 611
MaeIII GTNAC 4 cut(s) 173, 224, 290, 505
MalI GATC 2 cut(s) 273, 369
MboI GATC 2 cut(s) 271, 367
MboII GAAGA 5 cut(s) 80, 148, 211, 251, 394
MluCI AATT 3 cut(s) 167, 627, 708
MlyI GAGTC 1 cut(s) 635
MnlI CCTC 6 cut(s) 120, 273, 348, 410, 501, 591
MspA1I CMGCKG 1 cut(s) 36
MwoI GCNNNNNNNGC 3 cut(s) 33, 36, 39
NdeI CATATG 1 cut(s) 742
NdeII GATC 2 cut(s) 271, 367
NlaIII CATG 1 cut(s) 299
NmuCI GTSAC 2 cut(s) 173, 224
NspV TTCGAA 1 cut(s) 706
PfeI GAWTC 1 cut(s) 12
PflMI CCANNNNNTGG 1 cut(s) 141
PkrI GCNGC 7 cut(s) 29, 32, 35, 38, 41, 622, 677
PleI GAGTC 1 cut(s) 635
PpsI GAGTC 1 cut(s) 635
PspPI GGNCC 1 cut(s) 115
PstI CTGCAG 1 cut(s) 32
PstNI CAGNNNCTG 2 cut(s) 36, 39
PvuII CAGCTG 1 cut(s) 36
SatI GCNGC 7 cut(s) 28, 31, 34, 37, 40, 621, 676
Sau3AI GATC 2 cut(s) 271, 367
Sau96I GGNCC 1 cut(s) 115
SchI GAGTC 1 cut(s) 635
SetI ASST 9 cut(s) 38, 106, 112, 325, 499, 583, 616, 625, 665
SfaNI GCATC 2 cut(s) 505, 722
SfcI CTRYAG 1 cut(s) 28
SfuI TTCGAA 1 cut(s) 706
SinI GGWCC 1 cut(s) 115
Sse9I AATT 3 cut(s) 167, 627, 708
SsiI CCGC 2 cut(s) 118, 178
SspMI CTAG 1 cut(s) 611
TaaI ACNGT 1 cut(s) 505
TaqI TCGA 4 cut(s) 639, 644, 693, 706
TasI AATT 3 cut(s) 167, 627, 708
TfiI GAWTC 1 cut(s) 12
TscAI CASTG 3 cut(s) 70, 146, 349
TseFI GTSAC 2 cut(s) 173, 224
TseI GCWGC 7 cut(s) 27, 30, 33, 36, 39, 620, 675
Tsp45I GTSAC 2 cut(s) 173, 224
TspGWI ACGGA 1 cut(s) 212
TspRI CASTG 3 cut(s) 70, 146, 349
Van91I CCANNNNNTGG 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 1 cut(s) 167
XcmI CCANNNNNNNNNTGG 1 cut(s) 311
XspI CTAG 1 cut(s) 611
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.