RchiOBHm_Chr2g0175331

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
87596680 .. 87597460
781 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54242

Sequence Viewer

Length: 270 bp
ATGCATTCACGTTTGAGCATCTTTTCTCAGTCAGTGAGAGTAGATTTGTTAATCTCTGTAGTTTTTGGTATTGGTGAAACTAGGCTTTTGGTGCTGGTAAACTACCTTTCTAATGTTGGTGACATAGTTTTTGTCGTTGTAGCTTTTGTGACCTCGCCGGAGGTTGTTGGAAATCTCACCAGAGTAACTTTTATTGCTTGTGATAGTAGCTTTTATGACCTTACCGGAGGTTGCAGGAAATCTCACCAGAATAGCTTTTATTGCTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.82

Weight (kDa)

6.69

Isoelectric Point (pI)

48.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018157)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 143, 210, 255
AluI AGCT 3 cut(s) 143, 210, 255
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
AsuHPI GGTGA 4 cut(s) 86, 131, 169, 236
BfaI CTAG 1 cut(s) 81
BfmI CTRYAG 1 cut(s) 57
BmsI GCATC 1 cut(s) 27
BsaWI WCCGGW 1 cut(s) 224
BseMII CTCAG 1 cut(s) 41
BsiSI CCGG 2 cut(s) 158, 225
BsmI GAATGC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 27
BstMWI GCNNNNNNNGC 2 cut(s) 91, 261
BstSFI CTRYAG 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 39
CviJI RGCY 4 cut(s) 85, 143, 210, 255
CviKI_1 RGCY 4 cut(s) 85, 143, 210, 255
DdeI CTNAG 1 cut(s) 27
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 2 cut(s) 125, 216
FspBI CTAG 1 cut(s) 81
HapII CCGG 2 cut(s) 158, 225
HpaII CCGG 2 cut(s) 158, 225
HphI GGTGA 4 cut(s) 86, 131, 169, 236
Hpy166II GTNNAC 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 4, 234
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 261
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 10
LpnPI CCDG 6 cut(s) 80, 171, 193, 220, 238, 260
LweI GCATC 1 cut(s) 27
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 10
MaeIII GTNAC 3 cut(s) 119, 148, 184
MmeI TCCRAC 1 cut(s) 148
MnlI CCTC 3 cut(s) 154, 163, 221
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 50
MspI CCGG 2 cut(s) 158, 225
Mva1269I GAATGC 1 cut(s) 4
MwoI GCNNNNNNNGC 2 cut(s) 91, 261
NmuCI GTSAC 2 cut(s) 119, 148
NsiI ATGCAT 1 cut(s) 6
PctI GAATGC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 50
SetI ASST 9 cut(s) 13, 108, 145, 155, 165, 212, 222, 232, 257
SfaNI GCATC 1 cut(s) 27
SfcI CTRYAG 1 cut(s) 57
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 13
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TscAI CASTG 1 cut(s) 39
TseFI GTSAC 2 cut(s) 119, 148
Tsp45I GTSAC 2 cut(s) 119, 148
TspRI CASTG 1 cut(s) 39
XspI CTAG 1 cut(s) 81
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.