RchiOBHm_Chr3g0452531

SEC-C motif

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
3094597 .. 3095941
1345 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41967

Sequence Viewer

Length: 150 bp
ATGGGAAACCAATTCCAACAAACATTGGCGAGTTGCTTGCTTGTGCAAAAGTTGATGTGTTCAACCCCATTTGACCTTGCTCAGTCTAATTTGGCTAAGAGTGGACAAATTAGTAGGAATGCACTTTGTCCGTGTGGTTCCAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.26

Weight (kDa)

9.2

Isoelectric Point (pI)

42.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024909)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0452531
rosa_samantha Rh3AG043300 Rh3DG044400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 63
BcgI CGANNNNNNTGC 2 cut(s) 19, 53
BmiI GGNNCC 1 cut(s) 139
BseMII CTCAG 1 cut(s) 95
BsmI GAATGC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 2 cut(s) 81, 96
Cac8I GCNNGC 1 cut(s) 38
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 2 cut(s) 81, 96
Hpy166II GTNNAC 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 46, 122
HpyF3I CTNAG 2 cut(s) 81, 96
MluCI AATT 3 cut(s) 11, 88, 108
MmeI TCCRAC 1 cut(s) 40
Mva1269I GAATGC 1 cut(s) 124
NlaIV GGNNCC 1 cut(s) 139
PctI GAATGC 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 139
SetI ASST 1 cut(s) 78
SgeI CNNG 5 cut(s) 42, 49, 53, 89, 144
Sse9I AATT 3 cut(s) 11, 88, 108
TasI AATT 3 cut(s) 11, 88, 108
TspGWI ACGGA 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.