Rh3DG044400

SEC-C motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
2905833 .. 2908883
3051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG044400.1

Sequence Viewer

Length: 369 bp
ATGGAAAAGTTGAAAGCAGAAGAGAAACCAATTCCAACAAACATTGGTGAGGTGCAAAAGTTGATGTGTTCAACCCCATTTGACCTTGCTCAGTCTAATTTGGCTAAGAGTGGACAAATTAGTAGGAATGCACTTTGTCCGTGTGGTTCCAAGAAACGATACAGGCGGTTTATAATTGATAAGCGTATTGGTTTATGTGGCATGGAAAGGATAAGTGATCGCAGAATAAGAGGGAAGGAAAATCTTACTGCAGTCCACAGACACCTCAAGCTCGAAGAAAGAATTTTCAGTTTTTGGATTTTTTATGATTCTACTCTACTTGCTGAGATCAAATGTATTAATATTGTGTTATACAATAAATTGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

14.17

Weight (kDa)

9.68

Isoelectric Point (pI)

45.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024909)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0452531
rosa_samantha Rh3AG043300 Rh3DG044400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 173
AciI CCGC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 282
AgsI TTSAA 2 cut(s) 13, 72
AluBI AGCT 1 cut(s) 271
AluI AGCT 1 cut(s) 271
ApoI RAATTY 1 cut(s) 282
AseI ATTAAT 1 cut(s) 339
AsuHPI GGTGA 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 249
BmiI GGNNCC 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 251
BseMII CTCAG 2 cut(s) 104, 315
BsmI GAATGC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 217, 327
BspACI CCGC 1 cut(s) 166
BspCNI CTCAG 2 cut(s) 103, 316
BspLI GGNNCC 1 cut(s) 148
BspMAI CTGCAG 1 cut(s) 253
BssMI GATC 2 cut(s) 217, 327
Bst6I CTCTTC 1 cut(s) 15
BstDEI CTNAG 3 cut(s) 90, 105, 324
BstKTI GATC 2 cut(s) 220, 330
BstMBI GATC 2 cut(s) 217, 327
BstSFI CTRYAG 1 cut(s) 249
CviAII CATG 1 cut(s) 202
CviJI RGCY 2 cut(s) 104, 271
CviKI_1 RGCY 2 cut(s) 104, 271
DdeI CTNAG 3 cut(s) 90, 105, 324
DpnI GATC 2 cut(s) 219, 329
DpnII GATC 2 cut(s) 217, 327
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
FaeI CATG 1 cut(s) 205
FaiI YATR 5 cut(s) 173, 196, 203, 306, 352
FatI CATG 1 cut(s) 201
Hin1II CATG 1 cut(s) 205
HinfI GANTC 1 cut(s) 308
HphI GGTGA 1 cut(s) 59
Hpy166II GTNNAC 2 cut(s) 113, 256
Hpy8I GTNNAC 2 cut(s) 113, 256
HpyAV CCTTC 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 55, 131, 251
HpyF3I CTNAG 3 cut(s) 90, 105, 324
Hsp92II CATG 1 cut(s) 205
Kzo9I GATC 2 cut(s) 217, 327
LpnPI CCDG 1 cut(s) 148
MalI GATC 2 cut(s) 219, 329
MboI GATC 2 cut(s) 217, 327
MboII GAAGA 2 cut(s) 32, 287
MluCI AATT 6 cut(s) 30, 97, 117, 174, 282, 359
MmeI TCCRAC 1 cut(s) 59
MnlI CCTC 3 cut(s) 43, 224, 275
MseI TTAA 1 cut(s) 339
Mva1269I GAATGC 1 cut(s) 133
NdeII GATC 2 cut(s) 217, 327
NlaIII CATG 1 cut(s) 205
NlaIV GGNNCC 1 cut(s) 148
PctI GAATGC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 308
PshBI ATTAAT 1 cut(s) 339
PsiI TTATAA 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 148
PstI CTGCAG 1 cut(s) 253
SaqAI TTAA 1 cut(s) 339
Sau3AI GATC 2 cut(s) 217, 327
SetI ASST 4 cut(s) 54, 87, 267, 273
SfcI CTRYAG 1 cut(s) 249
SgeI CNNG 8 cut(s) 98, 153, 163, 175, 214, 280, 284, 332
SmlI CTYRAG 1 cut(s) 266
SmoI CTYRAG 1 cut(s) 266
Sse9I AATT 6 cut(s) 30, 97, 117, 174, 282, 359
SsiI CCGC 1 cut(s) 166
SspI AATATT 1 cut(s) 343
TaqI TCGA 1 cut(s) 273
TasI AATT 6 cut(s) 30, 97, 117, 174, 282, 359
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 1 cut(s) 339
Tru9I TTAA 1 cut(s) 339
TspGWI ACGGA 1 cut(s) 129
VspI ATTAAT 1 cut(s) 339
XapI RAATTY 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.