Rh3AG043300

SEC-C motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
2907319 .. 2908883
1565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG043300.1

Sequence Viewer

Length: 585 bp
ATGACATTGCATAGCACACCTGAATGTTTTTCCTCTATTATCAACACAATCCTTTTCCATATTCTTTGCCAATCTCTCATTGTAATTGACCATTTCAAAGCTGAGAATCTTCAAATCACGCAAAAACAAGAAGCAGCAAAGTATTGTAAATGCACAATAGCTGATGTTGAGAATGCACTTGCAAAGTTCACCTGGGCCAGAGAAGCACACAACAAGATGGAAAAGTTGAAAGCAGAAGAGAAACCAATTCCAACAAACATTGGTGAGGTGCAAAAGTTGATGTGTTCAACCCCATTTGACCTTGCTCAGTCTAATTTGGCTAAGAGTGGACAAATTAGTAGGAATGCACTTTGTCCGTGTGGTTCCAAGAAACGATACAGGCGGTTTATAATTGATAAGCGTATTGGTTTATGTGGCATGGAAAGGATAAGTGATCGCAGAATAAGAGGGAAGGAAAATCTTACTGCAGTCCACAGACACCTCAAGCTCGAAGAAAGAATTTTCAGTTTTTGGATTTTTTATGATTCTACTCTACTTGCTGAGATCAAATGTATTAATATTGTGTTATACAATAAATTGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

194

Amino Acids

22.38

Weight (kDa)

9.24

Isoelectric Point (pI)

47.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024909)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0452531
rosa_samantha Rh3AG043300 Rh3DG044400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 389
AciI CCGC 1 cut(s) 382
AcsI RAATTY 1 cut(s) 498
AgsI TTSAA 4 cut(s) 97, 113, 229, 288
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 3 cut(s) 101, 161, 487
AluI AGCT 3 cut(s) 101, 161, 487
AoxI GGCC 1 cut(s) 195
ApeKI GCWGC 1 cut(s) 134
ApoI RAATTY 1 cut(s) 498
AseI ATTAAT 1 cut(s) 555
AspS9I GGNCC 1 cut(s) 195
AsuHPI GGTGA 2 cut(s) 181, 275
BbvI GCAGC 1 cut(s) 146
BccI CCATC 1 cut(s) 211
BciT130I CCWGG 1 cut(s) 193
BfmI CTRYAG 1 cut(s) 465
BisI GCNGC 1 cut(s) 135
BlsI GCNGC 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 193
BmgT120I GGNCC 1 cut(s) 195
BmiI GGNNCC 1 cut(s) 364
BmrFI CCNGG 1 cut(s) 193
BpuEI CTTGAG 1 cut(s) 467
BsaJI CCNNGG 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 5
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 192
BseMI GCAATG 1 cut(s) 5
BseMII CTCAG 3 cut(s) 93, 320, 531
BseXI GCAGC 1 cut(s) 146
BshFI GGCC 1 cut(s) 197
BsmI GAATGC 2 cut(s) 178, 349
BsnI GGCC 1 cut(s) 197
Bsp143I GATC 2 cut(s) 433, 543
BspACI CCGC 1 cut(s) 382
BspANI GGCC 1 cut(s) 197
BspCNI CTCAG 3 cut(s) 94, 319, 532
BspLI GGNNCC 1 cut(s) 364
BspMAI CTGCAG 1 cut(s) 469
BsrDI GCAATG 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 2 cut(s) 433, 543
Bst2UI CCWGG 1 cut(s) 193
Bst6I CTCTTC 1 cut(s) 231
BstDEI CTNAG 4 cut(s) 102, 306, 321, 540
BstKTI GATC 2 cut(s) 436, 546
BstMBI GATC 2 cut(s) 433, 543
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 465
BstV1I GCAGC 1 cut(s) 146
BsuRI GGCC 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 195
CviAII CATG 1 cut(s) 418
CviJI RGCY 5 cut(s) 101, 161, 197, 320, 487
CviKI_1 RGCY 5 cut(s) 101, 161, 197, 320, 487
DdeI CTNAG 4 cut(s) 102, 306, 321, 540
DpnI GATC 2 cut(s) 435, 545
DpnII GATC 2 cut(s) 433, 543
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 191
FaeI CATG 1 cut(s) 421
FaiI YATR 7 cut(s) 12, 60, 389, 412, 419, 522, 568
FatI CATG 1 cut(s) 417
Fnu4HI GCNGC 1 cut(s) 135
Fsp4HI GCNGC 1 cut(s) 135
GluI GCNGC 1 cut(s) 135
HaeIII GGCC 1 cut(s) 197
Hin1II CATG 1 cut(s) 421
HinfI GANTC 2 cut(s) 106, 524
HphI GGTGA 2 cut(s) 181, 275
Hpy166II GTNNAC 3 cut(s) 189, 329, 472
Hpy8I GTNNAC 3 cut(s) 189, 329, 472
HpyAV CCTTC 1 cut(s) 445
HpyCH4V TGCA 7 cut(s) 10, 153, 176, 182, 271, 347, 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpyF3I CTNAG 4 cut(s) 102, 306, 321, 540
Hsp92II CATG 1 cut(s) 421
Kzo9I GATC 2 cut(s) 433, 543
LpnPI CCDG 5 cut(s) 33, 178, 205, 211, 364
Lsp1109I GCAGC 1 cut(s) 146
MalI GATC 2 cut(s) 435, 545
MboI GATC 2 cut(s) 433, 543
MboII GAAGA 3 cut(s) 101, 248, 503
MluCI AATT 7 cut(s) 84, 246, 313, 333, 390, 498, 575
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 4 cut(s) 43, 259, 440, 491
MseI TTAA 1 cut(s) 555
MslI CAYNNNNRTG 1 cut(s) 22
MspR9I CCNGG 1 cut(s) 193
Mva1269I GAATGC 2 cut(s) 178, 349
MvaI CCWGG 1 cut(s) 193
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 2 cut(s) 433, 543
NlaIII CATG 1 cut(s) 421
NlaIV GGNNCC 1 cut(s) 364
PctI GAATGC 2 cut(s) 178, 349
PfeI GAWTC 2 cut(s) 106, 524
PkrI GCNGC 1 cut(s) 136
PshBI ATTAAT 1 cut(s) 555
PsiI TTATAA 1 cut(s) 389
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 364
PspPI GGNCC 1 cut(s) 195
PstI CTGCAG 1 cut(s) 469
RseI CAYNNNNRTG 1 cut(s) 22
SaqAI TTAA 1 cut(s) 555
SatI GCNGC 1 cut(s) 135
Sau3AI GATC 2 cut(s) 433, 543
Sau96I GGNCC 1 cut(s) 195
ScrFI CCNGG 1 cut(s) 193
SetI ASST 8 cut(s) 22, 103, 163, 194, 270, 303, 483, 489
SfcI CTRYAG 1 cut(s) 465
SmiMI CAYNNNNRTG 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 482
SmoI CTYRAG 1 cut(s) 482
Sse9I AATT 7 cut(s) 84, 246, 313, 333, 390, 498, 575
SsiI CCGC 1 cut(s) 382
SspI AATATT 1 cut(s) 559
StyD4I CCNGG 1 cut(s) 191
TaqI TCGA 1 cut(s) 489
TasI AATT 7 cut(s) 84, 246, 313, 333, 390, 498, 575
TfiI GAWTC 2 cut(s) 106, 524
Tru1I TTAA 1 cut(s) 555
Tru9I TTAA 1 cut(s) 555
TseI GCWGC 1 cut(s) 134
TspGWI ACGGA 1 cut(s) 345
VspI ATTAAT 1 cut(s) 555
XapI RAATTY 1 cut(s) 498
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.