RchiOBHm_Chr3g0491521

Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
38261469 .. 38261705
237 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45449

Sequence Viewer

Length: 237 bp
ATGGCTGCAATTGACGTTCTCAAGTATGCTCATAGTCCTGCACACAAAGCCATAGTCACCAAGGACTATGCCAGTCTCAGGAGGATTCTTACAGCTCTTCCGATGAGTTTAAGGAGTTTACCTCACAAAAGGCATTTTCTTTGGAATCGAAGGCCAATCAGATATGATTTATTCCATATGATTCTGCATTCCATCTGGTTAAGCAGATTGAGCCAGATTCAAATCCCAGAATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

9.23

Weight (kDa)

10.97

Isoelectric Point (pI)

91.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019748)

Species Orthologous Gene IDs
malus_domestica MD13G1284900.v1.1
prunus_persica Prupe.7G222900_v2.0.a1
pyrus_communis pycom420g00680
rosa_chinensis RchiOBHm_Chr2g0105151 RchiOBHm_Chr2g0107541 RchiOBHm_Chr3g0491521
rosa_samantha Rh2AG221900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 78
AgsI TTSAA 1 cut(s) 221
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 152
ApeKI GCWGC 1 cut(s) 5
ArsI GACNNNNNNTTYG 2 cut(s) 39, 71
AsuHPI GGTGA 1 cut(s) 49
BccI CCATC 1 cut(s) 200
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 1 cut(s) 235
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BplI GAGNNNNNCTC 2 cut(s) 106, 138
BpuEI CTTGAG 1 cut(s) 5
BsaBI GATNNNNATC 1 cut(s) 221
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 78
Bse1I ACTGG 1 cut(s) 72
Bse8I GATNNNNATC 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 221
BseLI CCNNNNNNNGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 72
BsgI GTGCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 78
BsmAI GTCTC 1 cut(s) 80
BsmI GAATGC 1 cut(s) 187
BsnI GGCC 1 cut(s) 154
BspANI GGCC 1 cut(s) 154
BspCNI CTCAG 1 cut(s) 90
BspQI GCTCTTC 1 cut(s) 102
BsrI ACTGG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 77
BstMAI GTCTC 1 cut(s) 80
BstMWI GCNNNNNNNGC 2 cut(s) 47, 210
BsuRI GGCC 1 cut(s) 154
CviJI RGCY 5 cut(s) 5, 50, 95, 154, 213
CviKI_1 RGCY 5 cut(s) 5, 50, 95, 154, 213
DdeI CTNAG 1 cut(s) 77
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaiI YATR 7 cut(s) 27, 33, 53, 69, 165, 177, 179
FauNDI CATATG 1 cut(s) 177
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 235
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 154
HinfI GANTC 5 cut(s) 85, 145, 181, 217, 230
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 102, 161
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 144
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 3 cut(s) 8, 41, 187
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 210
HpyF3I CTNAG 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 15
LguI GCTCTTC 1 cut(s) 102
LpnPI CCDG 5 cut(s) 51, 64, 85, 181, 227
MaeI CTAG 1 cut(s) 235
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 1 cut(s) 89
MfeI CAATTG 1 cut(s) 9
MluCI AATT 1 cut(s) 9
MnlI CCTC 2 cut(s) 75, 132
MseI TTAA 2 cut(s) 110, 200
MunI CAATTG 1 cut(s) 9
Mva1269I GAATGC 1 cut(s) 187
MwoI GCNNNNNNNGC 2 cut(s) 47, 210
NdeI CATATG 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 55
PciSI GCTCTTC 1 cut(s) 102
PctI GAATGC 1 cut(s) 187
PfeI GAWTC 5 cut(s) 85, 145, 181, 217, 230
PkrI GCNGC 1 cut(s) 7
SapI GCTCTTC 1 cut(s) 102
SaqAI TTAA 2 cut(s) 110, 200
SatI GCNGC 1 cut(s) 6
SetI ASST 3 cut(s) 18, 97, 124
SgeI CNNG 7 cut(s) 34, 50, 73, 84, 91, 208, 226
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 1 cut(s) 9
SspMI CTAG 1 cut(s) 235
StyI CCWWGG 1 cut(s) 60
TaiI ACGT 1 cut(s) 18
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 9
TfiI GAWTC 5 cut(s) 85, 145, 181, 217, 230
Tru1I TTAA 2 cut(s) 110, 200
Tru9I TTAA 2 cut(s) 110, 200
TseFI GTSAC 1 cut(s) 55
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 55
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.