RchiOBHm_Chr4g0387861

Transcription factor ILR3-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
3024462 .. 3028325
3864 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36113

Sequence Viewer

Length: 189 bp
ATGAAGGAAACTGGGTTGAACAAATGTGCGAGGTCCAGATTGTGCAATGTGTTTGGTTCTAAAGCCTGTAGAGAGAAAATGCGGAGGGACAGACTGAATGACAAAGAACATTTGTGGGGGTGGACTTCTTTAGCGTATTTCAAAAGGTTTGTCTTCAAACAAAGGATCAGTGTGTATCTAATATTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.5

Weight (kDa)

10.3

Isoelectric Point (pI)

46.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024946)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0387861
rosa_samantha Rh1BG013200 Rh7AG335600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AclWI GGATC 1 cut(s) 173
AgsI TTSAA 3 cut(s) 19, 142, 157
AlwI GGATC 1 cut(s) 173
ArsI GACNNNNNNTTYG 2 cut(s) 135, 167
AspS9I GGNCC 1 cut(s) 33
AvaII GGWCC 1 cut(s) 33
BbsI GAAGAC 1 cut(s) 145
BfmI CTRYAG 1 cut(s) 67
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 33
BmrI ACTGGG 1 cut(s) 21
BmuI ACTGGG 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 16
Bse3DI GCAATG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 16
BslFI GGGAC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 165
BspACI CCGC 1 cut(s) 82
BspPI GGATC 1 cut(s) 173
BsrDI GCAATG 1 cut(s) 52
BsrI ACTGG 1 cut(s) 16
BssMI GATC 1 cut(s) 165
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BstSFI CTRYAG 1 cut(s) 67
BstV2I GAAGAC 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 33
CviJI RGCY 1 cut(s) 65
CviKI_1 RGCY 1 cut(s) 65
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eco47I GGWCC 1 cut(s) 33
FaqI GGGAC 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 123
Hpy188III TCNNGA 1 cut(s) 36
Hpy8I GTNNAC 1 cut(s) 123
HpyCH4V TGCA 1 cut(s) 45
Kzo9I GATC 1 cut(s) 165
LpnPI CCDG 2 cut(s) 49, 79
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 1 cut(s) 145
MnlI CCTC 2 cut(s) 24, 78
NdeII GATC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 33
Sau3AI GATC 1 cut(s) 165
Sau96I GGNCC 1 cut(s) 33
SetI ASST 2 cut(s) 35, 149
SfcI CTRYAG 1 cut(s) 67
SgeI CNNG 4 cut(s) 24, 42, 48, 78
SinI GGWCC 1 cut(s) 33
SsiI CCGC 1 cut(s) 82
SspI AATATT 1 cut(s) 183
TscAI CASTG 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.