RchiOBHm_Chr4g0398621

Protein of unknown function (DUF632)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0024966
Physical Location & Seq
Reverse (-)
15173186 .. 15174511
1326 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37078

Sequence Viewer

Length: 396 bp
ATGGACTATATGGACGGCGGTCCAGACGGCATGAATCCGTACCCGCCGCAGGGGTATATGCACATGAACTACATGAGGAACAAAGCGACGTCGTCTGTGGTGTACCAGCAGAAACCCATGAGCCCCGAGAACCTGTACCTTATGGGTGAATCCTCTAATTCATCAAATTGTCCTCACCCTTTAGACGGCGGCGCTAATCCTTTCCCTATTCTAGGTATTCCAATTACGGCAGTGGAACTAACGGTGGGTATTACGGTAATTCCTCACATGTGCATCCTTATGGGTGTCCTCGCCACCAGCTTCCCTGTCAAAGTCGCCGCCTCCACCACCTTTGTCGCCGAGAGCTTCGACCTGGGACTTCATAAACTCGTTCGAAAGCATAGAGAGTTCTCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF630 DUF632

Protein Analysis

131

Amino Acids

14.31

Weight (kDa)

6.16

Isoelectric Point (pI)

54.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024966)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0398621
rosa_samantha Rh3CG365000 Rh3DG368100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 92
AciI CCGC 5 cut(s) 18, 44, 47, 189, 318
AcyI GRCGYC 1 cut(s) 89
AfaI GTAC 3 cut(s) 41, 104, 137
AfiI CCNNNNNNNGG 4 cut(s) 49, 50, 185, 212
AflIII ACRYGT 1 cut(s) 267
AjnI CCWGG 1 cut(s) 351
AluBI AGCT 2 cut(s) 300, 345
AluI AGCT 2 cut(s) 300, 345
Ama87I CYCGRG 1 cut(s) 125
AspLEI GCGC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 20
AsuHPI GGTGA 2 cut(s) 158, 167
AsuII TTCGAA 1 cut(s) 373
AvaI CYCGRG 1 cut(s) 125
AvaII GGWCC 1 cut(s) 20
BanII GRGCYC 1 cut(s) 125
BauI CACGAG 1 cut(s) 391
BceAI ACGGC 4 cut(s) 31, 43, 202, 243
BciT130I CCWGG 1 cut(s) 353
BfaI CTAG 1 cut(s) 212
BfoI RGCGCY 1 cut(s) 195
BisI GCNGC 3 cut(s) 47, 190, 318
BlsI GCNGC 3 cut(s) 48, 191, 319
Bme1390I CCNGG 1 cut(s) 353
Bme18I GGWCC 1 cut(s) 20
BmeT110I CYCGRG 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 353
BmsI GCATC 1 cut(s) 282
BoxI GACNNNNGTC 1 cut(s) 18
Bpu14I TTCGAA 1 cut(s) 373
BsaHI GRCGYC 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 352
Bsc4I CCNNNNNNNGG 4 cut(s) 49, 50, 185, 212
BseBI CCWGG 1 cut(s) 353
BseDI CCNNGG 1 cut(s) 352
BseGI GGATG 1 cut(s) 273
BseLI CCNNNNNNNGG 4 cut(s) 49, 50, 185, 212
BsiHKCI CYCGRG 1 cut(s) 125
BslFI GGGAC 1 cut(s) 369
BslI CCNNNNNNNGG 4 cut(s) 49, 50, 185, 212
BsmFI GGGAC 1 cut(s) 369
BsoBI CYCGRG 1 cut(s) 125
Bsp119I TTCGAA 1 cut(s) 373
Bsp1286I GDGCHC 1 cut(s) 125
BspACI CCGC 5 cut(s) 18, 44, 47, 189, 318
BspT104I TTCGAA 1 cut(s) 373
BssECI CCNNGG 1 cut(s) 352
BssNI GRCGYC 1 cut(s) 89
BssSI CACGAG 1 cut(s) 391
Bst2BI CACGAG 1 cut(s) 391
Bst2UI CCWGG 1 cut(s) 353
Bst4CI ACNGT 2 cut(s) 244, 256
BstACI GRCGYC 1 cut(s) 89
BstBI TTCGAA 1 cut(s) 373
BstENI CCTNNNNNAGG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 273
BstH2I RGCGCY 1 cut(s) 195
BstHHI GCGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 353
BstNSI RCATGY 1 cut(s) 271
BstPAI GACNNNNGTC 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 351
BtsCI GGATG 1 cut(s) 273
BtsI GCAGTG 1 cut(s) 237
BtsIMutI CAGTG 1 cut(s) 237
CfoI GCGC 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 20
Csp6I GTAC 3 cut(s) 40, 103, 136
CspCI CAANNNNNGTGG 2 cut(s) 313, 348
CviAII CATG 5 cut(s) 31, 64, 73, 118, 268
CviJI RGCY 3 cut(s) 123, 300, 345
CviKI_1 RGCY 3 cut(s) 123, 300, 345
CviQI GTAC 3 cut(s) 40, 103, 136
Eco24I GRGCYC 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 20
Eco88I CYCGRG 1 cut(s) 125
EcoNI CCTNNNNNAGG 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 351
EcoT38I GRGCYC 1 cut(s) 125
FaeI CATG 5 cut(s) 34, 67, 76, 121, 271
FaqI GGGAC 1 cut(s) 369
FatI CATG 5 cut(s) 30, 63, 72, 117, 267
FauI CCCGC 1 cut(s) 51
Fnu4HI GCNGC 3 cut(s) 47, 190, 318
FokI GGATG 1 cut(s) 260
FriOI GRGCYC 1 cut(s) 125
Fsp4HI GCNGC 3 cut(s) 47, 190, 318
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 193
GluI GCNGC 3 cut(s) 47, 190, 318
HaeII RGCGCY 1 cut(s) 195
HhaI GCGC 1 cut(s) 194
Hin1I GRCGYC 1 cut(s) 89
Hin1II CATG 5 cut(s) 34, 67, 76, 121, 271
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HinfI GANTC 2 cut(s) 34, 149
HphI GGTGA 2 cut(s) 158, 167
Hpy166II GTNNAC 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 23, 393
Hpy8I GTNNAC 1 cut(s) 103
Hpy99I CGWCG 2 cut(s) 91, 94
HpyCH4III ACNGT 2 cut(s) 244, 256
HpyCH4IV ACGT 1 cut(s) 89
HpyCH4V TGCA 2 cut(s) 61, 273
HpySE526I ACGT 1 cut(s) 89
Hsp92I GRCGYC 1 cut(s) 89
Hsp92II CATG 5 cut(s) 34, 67, 76, 121, 271
HspAI GCGC 1 cut(s) 192
LpnPI CCDG 8 cut(s) 35, 36, 119, 146, 310, 318, 338, 365
LweI GCATC 1 cut(s) 282
MaeI CTAG 1 cut(s) 212
MaeII ACGT 1 cut(s) 89
MhlI GDGCHC 1 cut(s) 125
MluCI AATT 4 cut(s) 157, 166, 222, 258
MnlI CCTC 6 cut(s) 69, 163, 183, 273, 299, 331
MslI CAYNNNNRTG 1 cut(s) 278
MspR9I CCNGG 1 cut(s) 353
MvaI CCWGG 1 cut(s) 353
NlaIII CATG 5 cut(s) 34, 67, 76, 121, 271
NmeAIII GCCGAG 1 cut(s) 364
NspI RCATGY 1 cut(s) 271
NspV TTCGAA 1 cut(s) 373
PciI ACATGT 1 cut(s) 267
PfeI GAWTC 2 cut(s) 34, 149
PflFI GACNNNGTC 1 cut(s) 91
PkrI GCNGC 3 cut(s) 48, 191, 319
PscI ACATGT 1 cut(s) 267
PshAI GACNNNNGTC 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 351
PspGI CCWGG 1 cut(s) 351
PspPI GGNCC 1 cut(s) 20
PsyI GACNNNGTC 1 cut(s) 91
RsaI GTAC 3 cut(s) 41, 104, 137
RsaNI GTAC 3 cut(s) 40, 103, 136
RseI CAYNNNNRTG 1 cut(s) 278
SatI GCNGC 3 cut(s) 47, 190, 318
Sau96I GGNCC 1 cut(s) 20
ScrFI CCNGG 1 cut(s) 353
SduI GDGCHC 1 cut(s) 125
SetI ASST 8 cut(s) 92, 135, 141, 217, 302, 332, 347, 354
SfaNI GCATC 1 cut(s) 282
SfuI TTCGAA 1 cut(s) 373
SinI GGWCC 1 cut(s) 20
SmiMI CAYNNNNRTG 1 cut(s) 278
Sse9I AATT 4 cut(s) 157, 166, 222, 258
SsiI CCGC 5 cut(s) 18, 44, 47, 189, 318
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 351
TaaI ACNGT 2 cut(s) 244, 256
TaiI ACGT 1 cut(s) 92
TaqI TCGA 2 cut(s) 348, 373
TasI AATT 4 cut(s) 157, 166, 222, 258
TauI GCSGC 3 cut(s) 49, 192, 320
TfiI GAWTC 2 cut(s) 34, 149
TscAI CASTG 1 cut(s) 237
TspDTI ATGAA 4 cut(s) 47, 80, 150, 350
TspGWI ACGGA 1 cut(s) 27
TspRI CASTG 1 cut(s) 237
Tth111I GACNNNGTC 1 cut(s) 91
VpaK11BI GGWCC 1 cut(s) 20
XagI CCTNNNNNAGG 1 cut(s) 210
XceI RCATGY 1 cut(s) 271
XspI CTAG 1 cut(s) 212
ZraI GACGTC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.