RchiOBHm_Chr4g0420591

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
46362015 .. 46366872
4858 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39032

Sequence Viewer

Length: 279 bp
ATGTGCAAGGAAAATATGATTCCAGACATGATAGCTAGTGCTGAGACAATGCTAGTGAGGTGGAAAAGCCATGAAAAAGGGAAAGAAATGGAAGTGTATGAAGAATTTAGATTGTTTACTTCAGAAGTGATTGCTAGGACAGCATTTGGCAGCAGCTATGTAGAAGGGAAGAACATTTTTGATATGTTGATGAAATTAAGCTTACTCAAAAATGATTTCAAACTCAAGTTTCCAGGCTTTAGGTACACATATCTATATTCCTACACTCTTGTCTGGTAG

Protein Analysis

92

Amino Acids

10.97

Weight (kDa)

7.8

Isoelectric Point (pI)

17.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022561)

Species Orthologous Gene IDs
pyrus_communis pycom13g05090
rosa_chinensis RchiOBHm_Chr2g0110951 RchiOBHm_Chr4g0420591
rosa_multiflora Rmu_sc0002137.1_g000018

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 104
AcuI CTGAAG 1 cut(s) 105
AfaI GTAC 1 cut(s) 245
AgsI TTSAA 1 cut(s) 220
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 3 cut(s) 35, 156, 201
AluI AGCT 3 cut(s) 35, 156, 201
Alw26I GTCTC 1 cut(s) 38
ApeKI GCWGC 2 cut(s) 150, 153
ApoI RAATTY 1 cut(s) 104
BbvI GCAGC 2 cut(s) 162, 165
BciT130I CCWGG 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 38
BfaI CTAG 3 cut(s) 36, 53, 135
BisI GCNGC 2 cut(s) 151, 154
BlsI GCNGC 2 cut(s) 152, 155
Bme1390I CCNGG 1 cut(s) 234
BmrFI CCNGG 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 209
BseBI CCWGG 1 cut(s) 234
BseMII CTCAG 1 cut(s) 33
BseXI GCAGC 2 cut(s) 162, 165
BsmAI GTCTC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 234
BstDEI CTNAG 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 38
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BstV1I GCAGC 2 cut(s) 162, 165
Csp6I GTAC 1 cut(s) 244
CviAII CATG 2 cut(s) 28, 71
CviJI RGCY 5 cut(s) 35, 69, 156, 201, 237
CviKI_1 RGCY 5 cut(s) 35, 69, 156, 201, 237
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 1 cut(s) 42
Eco57I CTGAAG 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 232
FaeI CATG 2 cut(s) 31, 74
FaiI YATR 8 cut(s) 17, 29, 72, 99, 159, 185, 250, 256
FatI CATG 2 cut(s) 27, 70
Fnu4HI GCNGC 2 cut(s) 151, 154
Fsp4HI GCNGC 2 cut(s) 151, 154
FspBI CTAG 3 cut(s) 36, 53, 135
GluI GCNGC 2 cut(s) 151, 154
Hin1II CATG 2 cut(s) 31, 74
HindIII AAGCTT 1 cut(s) 199
HinfI GANTC 1 cut(s) 19
Hpy166II GTNNAC 2 cut(s) 117, 246
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 2 cut(s) 117, 246
HpyAV CCTTC 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 6
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 2 cut(s) 31, 74
LpnPI CCDG 4 cut(s) 36, 219, 246, 259
Lsp1109I GCAGC 2 cut(s) 162, 165
MaeI CTAG 3 cut(s) 36, 53, 135
MboII GAAGA 2 cut(s) 113, 181
MluCI AATT 2 cut(s) 104, 194
MnlI CCTC 1 cut(s) 51
MseI TTAA 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 140
NlaIII CATG 2 cut(s) 31, 74
PfeI GAWTC 1 cut(s) 19
PkrI GCNGC 2 cut(s) 152, 155
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 2 cut(s) 151, 154
ScrFI CCNGG 1 cut(s) 234
SetI ASST 5 cut(s) 37, 62, 158, 203, 245
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
Sse9I AATT 2 cut(s) 104, 194
SspMI CTAG 3 cut(s) 36, 53, 135
StyD4I CCNGG 1 cut(s) 232
TasI AATT 2 cut(s) 104, 194
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TseI GCWGC 2 cut(s) 150, 153
TspDTI ATGAA 3 cut(s) 87, 114, 206
XapI RAATTY 1 cut(s) 104
XspI CTAG 3 cut(s) 36, 53, 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.