Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002137.1

Orthogroup ID

OG0022561

Physical Location & Seq

Genomic Coordinates Forward (+)

73872 .. 76031

Gene Structure 2160 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002137.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atggttccagatatgatagctagtgctgagaagatgctgcaaaggttgcaaaatagccaggacaaagagatcgagatgtaccaagaatttaagttgtttacttcagaggtgattgccaaaacagcatttggcagcagctatttagaagggaagaaaattttcgacatgttgacagagttatcgttgttactgttcaaaaattcttataacatcaggcttcccggtatccgccgacccgacccggattttctgaccttttccagcgtcctccgaccaagccaccaacgcagacttcttcgccgctacctccctgttctccctttggtgctcgacagcgacgacaactaccataagcggtggatcagagctgtggaatccagctcggtcggattttgccgatttgggcatcacacggaccgatcctctgggttctggattcctcttctccacttgatcacacctgtgccagccttgaagcacgattttgcgtgtggagcgaaagatcaaggttggaagatcaacgactcatatcggttctgtagatcagaaggccacgattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0006629 GO:0008150 GO:0008152 GO:0008202 GO:0008395 GO:0009719 GO:0009725 GO:0009741 GO:0010033 GO:0010268 GO:0010817 GO:0014070 GO:0016128 GO:0016131 GO:0016491 GO:0033993 GO:0042221 GO:0042445 GO:0042592 GO:0044238 GO:0048878 GO:0050896 GO:0055088 GO:0055114 GO:0065007 GO:0065008 GO:0071704 GO:1901360 GO:1901615 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00905 map00905

Pfam Domains

Protein Families

p450

Protein Analysis

186

Amino Acids

21.64

Weight (kDa)

8.99

Isoelectric Point (pI)

65.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022561)

Species	Orthologous Gene IDs
pyrus_communis	pycom13g05090
rosa_chinensis	RchiOBHm_Chr2g0110951 RchiOBHm_Chr4g0420591
rosa_multiflora	Rmu_sc0002137.1_g000018

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	207
AciI	CCGC	3 cut(s)	229, 301, 355
AclWI	GGATC	2 cut(s)	368, 414
AcsI	RAATTY	3 cut(s)	86, 156, 199
AcuI	CTGAAG	1 cut(s)	87
AfaI	GTAC	1 cut(s)	80
AflIII	ACRYGT	1 cut(s)	165
AgsI	TTSAA	2 cut(s)	196, 475
AjnI	CCWGG	1 cut(s)	57
AjuI	GAANNNNNNNTTGG	2 cut(s)	276, 308
AleI	CACNNNNGTG	1 cut(s)	461
AluBI	AGCT	4 cut(s)	20, 138, 368, 381
AluI	AGCT	4 cut(s)	20, 138, 368, 381
Alw21I	GWGCWC	1 cut(s)	330
AlwI	GGATC	2 cut(s)	368, 414
AoxI	GGCC	1 cut(s)	550
ApeKI	GCWGC	3 cut(s)	37, 132, 135
ApoI	RAATTY	3 cut(s)	86, 156, 199
Asp700I	GAANNNNTTC	1 cut(s)	158
AspS9I	GGNCC	1 cut(s)	415
AsuC2I	CCSGG	2 cut(s)	222, 242
AsuHPI	GGTGA	1 cut(s)	121
AvaII	GGWCC	1 cut(s)	415
Bbv12I	GWGCWC	1 cut(s)	330
BbvI	GCAGC	3 cut(s)	24, 144, 147
BciT130I	CCWGG	1 cut(s)	59
BciVI	GTATCC	1 cut(s)	236
BclI	TGATCA	1 cut(s)	453
BcnI	CCSGG	2 cut(s)	222, 242
BfaI	CTAG	1 cut(s)	21
BfmI	CTRYAG	1 cut(s)	538
BfuI	GTATCC	1 cut(s)	236
BisI	GCNGC	4 cut(s)	38, 133, 136, 301
BlsI	GCNGC	4 cut(s)	39, 134, 137, 302
Bme1390I	CCNGG	3 cut(s)	59, 222, 242
Bme18I	GGWCC	1 cut(s)	415
BmgT120I	GGNCC	1 cut(s)	415
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	3 cut(s)	59, 222, 242
BmsI	GCATC	2 cut(s)	24, 415
BpuMI	CCSGG	2 cut(s)	222, 242
BseBI	CCWGG	1 cut(s)	59
BseMII	CTCAG	1 cut(s)	18
BseXI	GCAGC	3 cut(s)	24, 144, 147
Bsh1285I	CGRYCG	1 cut(s)	387
BshFI	GGCC	1 cut(s)	552
BsiEI	CGRYCG	1 cut(s)	387
BsiHKAI	GWGCWC	1 cut(s)	330
BsiSI	CCGG	2 cut(s)	222, 242
BsnI	GGCC	1 cut(s)	552
Bsp1286I	GDGCHC	1 cut(s)	330
Bsp143I	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
BspACI	CCGC	3 cut(s)	229, 301, 355
BspANI	GGCC	1 cut(s)	552
BspCNI	CTCAG	1 cut(s)	19
BspLI	GGNNCC	1 cut(s)	6
BspPI	GGATC	2 cut(s)	368, 414
BssMI	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
Bst2UI	CCWGG	1 cut(s)	59
Bst4CI	ACNGT	1 cut(s)	192
Bst6I	CTCTTC	1 cut(s)	447
BstAPI	GCANNNNNTGC	1 cut(s)	46
BstC8I	GCNNGC	1 cut(s)	468
BstDEI	CTNAG	1 cut(s)	27
BstKTI	GATC	7 cut(s)	72, 363, 422, 456, 505, 519, 545
BstMBI	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
BstMCI	CGRYCG	1 cut(s)	387
BstMWI	GCNNNNNNNGC	4 cut(s)	46, 122, 285, 494
BstNI	CCWGG	1 cut(s)	59
BstNSI	RCATGY	1 cut(s)	169
BstSCI	CCNGG	3 cut(s)	57, 220, 240
BstSFI	CTRYAG	1 cut(s)	538
BstV1I	GCAGC	3 cut(s)	24, 144, 147
BsuI	GTATCC	1 cut(s)	236
BsuRI	GGCC	1 cut(s)	552
Cac8I	GCNNGC	1 cut(s)	468
Cfr13I	GGNCC	1 cut(s)	415
CpoI	CGGWCCG	1 cut(s)	415
CseI	GACGC	1 cut(s)	253
Csp6I	GTAC	1 cut(s)	79
CspI	CGGWCCG	1 cut(s)	415
CviAII	CATG	1 cut(s)	166
CviJI	RGCY	9 cut(s)	20, 57, 138, 217, 279, 368, 381, 470, 552
CviKI_1	RGCY	9 cut(s)	20, 57, 138, 217, 279, 368, 381, 470, 552
CviQI	GTAC	1 cut(s)	79
DdeI	CTNAG	1 cut(s)	27
DpnI	GATC	7 cut(s)	71, 362, 421, 455, 504, 518, 544
DpnII	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
Eam1104I	CTCTTC	1 cut(s)	447
EarI	CTCTTC	1 cut(s)	447
EciI	GGCGGA	1 cut(s)	218
Eco47I	GGWCC	1 cut(s)	415
Eco57I	CTGAAG	1 cut(s)	87
EcoRII	CCWGG	1 cut(s)	57
FaeI	CATG	1 cut(s)	169
FaiI	YATR	5 cut(s)	14, 167, 207, 351, 529
FatI	CATG	1 cut(s)	165
FbaI	TGATCA	1 cut(s)	453
Fnu4HI	GCNGC	4 cut(s)	38, 133, 136, 301
Fsp4HI	GCNGC	4 cut(s)	38, 133, 136, 301
FspBI	CTAG	1 cut(s)	21
GluI	GCNGC	4 cut(s)	38, 133, 136, 301
HaeIII	GGCC	1 cut(s)	552
HapII	CCGG	2 cut(s)	222, 242
HgaI	GACGC	1 cut(s)	253
Hin1II	CATG	1 cut(s)	169
HincII	GTYRAC	1 cut(s)	171
HindII	GTYRAC	1 cut(s)	171
HinfI	GANTC	3 cut(s)	374, 436, 524
HpaII	CCGG	2 cut(s)	222, 242
HphI	GGTGA	1 cut(s)	121
Hpy166II	GTNNAC	2 cut(s)	99, 171
Hpy188I	TCNGA	6 cut(s)	106, 252, 272, 365, 389, 547
Hpy188III	TCNNGA	3 cut(s)	8, 73, 433
Hpy8I	GTNNAC	2 cut(s)	99, 171
Hpy99I	CGWCG	1 cut(s)	341
HpyAV	CCTTC	2 cut(s)	140, 542
HpyCH4III	ACNGT	1 cut(s)	192
HpyCH4V	TGCA	2 cut(s)	40, 49
HpyF10VI	GCNNNNNNNGC	4 cut(s)	46, 122, 285, 494
HpyF3I	CTNAG	1 cut(s)	27
Hsp92II	CATG	1 cut(s)	169
Ksp22I	TGATCA	1 cut(s)	453
Kzo9I	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
LmnI	GCTCC	1 cut(s)	494
Lsp1109I	GCAGC	3 cut(s)	24, 144, 147
LweI	GCATC	2 cut(s)	24, 415
MaeI	CTAG	1 cut(s)	21
MaeIII	GTNAC	1 cut(s)	186
MalI	GATC	7 cut(s)	71, 362, 421, 455, 504, 518, 544
MboI	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
MboII	GAAGA	5 cut(s)	43, 163, 287, 434, 526
MhlI	GDGCHC	1 cut(s)	330
MluCI	AATT	3 cut(s)	86, 156, 199
MlyI	GAGTC	1 cut(s)	518
MmeI	TCCRAC	3 cut(s)	295, 367, 491
MnlI	CCTC	5 cut(s)	100, 278, 317, 433, 450
MroXI	GAANNNNTTC	1 cut(s)	158
MseI	TTAA	1 cut(s)	90
MslI	CAYNNNNRTG	1 cut(s)	461
MspI	CCGG	2 cut(s)	222, 242
MspR9I	CCNGG	3 cut(s)	59, 222, 242
MvaI	CCWGG	1 cut(s)	59
MwoI	GCNNNNNNNGC	4 cut(s)	46, 122, 285, 494
NciI	CCSGG	2 cut(s)	222, 242
NdeII	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
NlaIII	CATG	1 cut(s)	169
NlaIV	GGNNCC	1 cut(s)	6
NspI	RCATGY	1 cut(s)	169
OliI	CACNNNNGTG	1 cut(s)	461
PciI	ACATGT	1 cut(s)	165
PcsI	WCGNNNNNNNCGW	1 cut(s)	336
PdmI	GAANNNNTTC	1 cut(s)	158
PfeI	GAWTC	2 cut(s)	374, 436
PkrI	GCNGC	4 cut(s)	39, 134, 137, 302
PleI	GAGTC	1 cut(s)	518
PpsI	GAGTC	1 cut(s)	518
PscI	ACATGT	1 cut(s)	165
PsiI	TTATAA	1 cut(s)	207
Psp6I	CCWGG	1 cut(s)	57
PspGI	CCWGG	1 cut(s)	57
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	1 cut(s)	415
RsaI	GTAC	1 cut(s)	80
RsaNI	GTAC	1 cut(s)	79
RseI	CAYNNNNRTG	1 cut(s)	461
Rsr2I	CGGWCCG	1 cut(s)	415
RsrII	CGGWCCG	1 cut(s)	415
SaqAI	TTAA	1 cut(s)	90
SatI	GCNGC	4 cut(s)	38, 133, 136, 301
Sau3AI	GATC	7 cut(s)	69, 360, 419, 453, 502, 516, 542
Sau96I	GGNCC	1 cut(s)	415
SchI	GAGTC	1 cut(s)	518
ScrFI	CCNGG	3 cut(s)	59, 222, 242
SduI	GDGCHC	1 cut(s)	330
SfaNI	GCATC	2 cut(s)	24, 415
SfcI	CTRYAG	1 cut(s)	538
SinI	GGWCC	1 cut(s)	415
SmiMI	CAYNNNNRTG	1 cut(s)	461
Sse9I	AATT	3 cut(s)	86, 156, 199
SsiI	CCGC	3 cut(s)	229, 301, 355
SspMI	CTAG	1 cut(s)	21
StyD4I	CCNGG	3 cut(s)	57, 220, 240
TaaI	ACNGT	1 cut(s)	192
TaqI	TCGA	3 cut(s)	72, 162, 330
TaqII	GACCGA	2 cut(s)	373, 432
TasI	AATT	3 cut(s)	86, 156, 199
TauI	GCSGC	1 cut(s)	303
TfiI	GAWTC	2 cut(s)	374, 436
Tru1I	TTAA	1 cut(s)	90
Tru9I	TTAA	1 cut(s)	90
TseI	GCWGC	3 cut(s)	37, 132, 135
TspGWI	ACGGA	1 cut(s)	428
VpaK11BI	GGWCC	1 cut(s)	415
XapI	RAATTY	3 cut(s)	86, 156, 199
XceI	RCATGY	1 cut(s)	169
XmnI	GAANNNNTTC	1 cut(s)	158
XspI	CTAG	1 cut(s)	21

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.